Transcript: Mouse NM_001081324.1

Mus musculus neuropilin (NRP) and tolloid (TLL)-like 2 (Neto2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Neto2 (74513)
Length:
5646
CDS:
37..1698

Additional Resources:

NCBI RefSeq record:
NM_001081324.1
NBCI Gene record:
Neto2 (74513)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081324.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086943 GCCCTTCATAACTTATCATAA pLKO.1 1794 3UTR 100% 13.200 18.480 N Neto2 n/a
2 TRCN0000086946 GCTATTATATAGAGCCATCAT pLKO.1 413 CDS 100% 4.950 6.930 N Neto2 n/a
3 TRCN0000086944 CGGGAAGATTCATGTGGATTA pLKO.1 539 CDS 100% 10.800 7.560 N Neto2 n/a
4 TRCN0000086945 GCATCCATATCCATCGACTTT pLKO.1 1675 CDS 100% 4.950 3.465 N Neto2 n/a
5 TRCN0000086947 GCAGTCTATGATGGAAGCAGT pLKO.1 838 CDS 100% 2.640 1.848 N Neto2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081324.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12728 pDONR223 100% 24.2% 26% None (many diffs) n/a
2 ccsbBroad304_12728 pLX_304 0% 24.2% 26% V5 (many diffs) n/a
3 TRCN0000469206 TTTGATATTGTAGGTATGTGATCT pLX_317 98.7% 24.2% 26% V5 (many diffs) n/a
Download CSV