Transcript: Mouse NM_001081471.1

Mus musculus methyltransferase like 7A3 (Mettl7a3), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Mettl7a3 (668178)
Length:
1446
CDS:
2..736

Additional Resources:

NCBI RefSeq record:
NM_001081471.1
NBCI Gene record:
Mettl7a3 (668178)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081471.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271028 GGAGACACTTAGCATCCAAAT pLKO_005 1271 3UTR 100% 10.800 7.560 N Mettl7a3 n/a
2 TRCN0000271029 TCGTGGCGTTTCCCATATTTC pLKO_005 42 CDS 100% 13.200 7.920 N Mettl7a3 n/a
3 TRCN0000347708 GAACGGTCTACCTGGAATTAC pLKO_005 536 CDS 100% 13.200 6.600 Y Mettl7a3 n/a
4 TRCN0000347783 TGAAGCGGTTCGCCATGATAT pLKO_005 120 CDS 100% 13.200 6.600 Y Mettl7a3 n/a
5 TRCN0000271095 TTGGAAGATGGCGAGCCTAAA pLKO_005 145 CDS 100% 10.800 5.400 Y Mettl7a3 n/a
6 TRCN0000097571 CGGTTCGCCATGATATACAAT pLKO.1 125 CDS 100% 5.625 2.813 Y Mettl7a2 n/a
7 TRCN0000180184 CGGTTCGCCATGATATACAAT pLKO.1 125 CDS 100% 5.625 2.813 Y Methig1 n/a
8 TRCN0000183038 CTTTGAGAAGTTCTTGTTCAA pLKO.1 307 CDS 100% 4.950 2.475 Y Methig1 n/a
9 TRCN0000097559 CCGAATAAATAAATCCCAGAA pLKO.1 986 3UTR 100% 4.050 2.025 Y Mettl7a1 n/a
10 TRCN0000183893 CTTCAGCAATCTGCAGGAGTT pLKO.1 175 CDS 100% 4.050 2.025 Y Methig1 n/a
11 TRCN0000097570 CGCCATGATATACAATTGGAA pLKO.1 130 CDS 100% 3.000 1.500 Y Mettl7a2 n/a
12 TRCN0000097573 GTGGTCTGCATCGTGGCGTTT pLKO.1 32 CDS 100% 1.350 0.675 Y Mettl7a2 n/a
13 TRCN0000097572 CTGGCTCGTGTGTGGTTCCTT pLKO.1 572 CDS 100% 1.000 0.500 Y Mettl7a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081471.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.