Transcript: Human NM_001083608.2

Homo sapiens nuclear prelamin A recognition factor (NARF), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
NARF (26502)
Length:
3670
CDS:
64..1290

Additional Resources:

NCBI RefSeq record:
NM_001083608.2
NBCI Gene record:
NARF (26502)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001083608.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064219 GCGTGTTAACATCAGGTGAAA pLKO.1 674 CDS 100% 4.950 6.930 N NARF n/a
2 TRCN0000299814 GCGTGTTAACATCAGGTGAAA pLKO_005 674 CDS 100% 4.950 6.930 N NARF n/a
3 TRCN0000064222 CTGGCACACATCTTCAGACAT pLKO.1 814 CDS 100% 4.950 3.465 N NARF n/a
4 TRCN0000299813 CTGGCACACATCTTCAGACAT pLKO_005 814 CDS 100% 4.950 3.465 N NARF n/a
5 TRCN0000064218 GCTAAATTCAACCTCAGTGTA pLKO.1 241 CDS 100% 4.950 3.465 N NARF n/a
6 TRCN0000299744 GCTAAATTCAACCTCAGTGTA pLKO_005 241 CDS 100% 4.950 3.465 N NARF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001083608.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08018 pDONR223 100% 99.9% 99.7% None 10G>A n/a
2 ccsbBroad304_08018 pLX_304 0% 99.9% 99.7% V5 10G>A n/a
3 TRCN0000466745 GTAAGCTGTGGGATGTCCCGAATG pLX_317 26.1% 99.9% 99.7% V5 10G>A n/a
4 ccsbBroadEn_08019 pDONR223 100% 81.2% 81% None 106_107ins144;623_624ins138;1160G>A n/a
5 ccsbBroad304_08019 pLX_304 0% 81.2% 81% V5 106_107ins144;623_624ins138;1160G>A n/a
6 TRCN0000467775 AATGTCAATCCCCGATGTAATACG pLX_317 24.9% 81.2% 81% V5 106_107ins144;623_624ins138;1160G>A n/a
Download CSV