Transcript: Mouse NM_001085378.2

Mus musculus myosin, heavy chain 7B, cardiac muscle, beta (Myh7b), mRNA.

Source:
NCBI, updated 2017-04-23
Taxon:
Mus musculus (mouse)
Gene:
Myh7b (668940)
Length:
6132
CDS:
91..5916

Additional Resources:

NCBI RefSeq record:
NM_001085378.2
NBCI Gene record:
Myh7b (668940)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001085378.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262993 GGCGGTTACAAACGGAGAATG pLKO_005 3944 CDS 100% 10.800 15.120 N Myh7b n/a
2 TRCN0000140235 GAGCAAGGTCAAGAGCTACAA pLKO.1 5727 CDS 100% 4.950 3.960 N MYH7B n/a
3 TRCN0000262995 TTCTGGGAAGTCACCTAATTT pLKO_005 1767 CDS 100% 15.000 10.500 N Myh7b n/a
4 TRCN0000262994 TGCGATCCTGTTGTCTCTTTC pLKO_005 5949 3UTR 100% 10.800 7.560 N Myh7b n/a
5 TRCN0000281574 GAGAAGTGTGCCTGCTATAAG pLKO_005 1132 CDS 100% 13.200 7.920 N Myh7b n/a
6 TRCN0000140236 GTTAACACCAAGCGGGTCATT pLKO.1 643 CDS 100% 4.950 2.970 N MYH7B n/a
7 TRCN0000140638 GCAGTTCTTCAACCAGCACAT pLKO.1 1557 CDS 100% 4.050 2.430 N MYH7B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001085378.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12383 pDONR223 100% 7.8% 8.2% None (many diffs) n/a
2 ccsbBroad304_12383 pLX_304 0% 7.8% 8.2% V5 (many diffs) n/a
3 TRCN0000470410 AAGTCCAACCTTAGTTTGTGGGTA pLX_317 75.2% 7.8% 8.2% V5 (many diffs) n/a
Download CSV