Transcript: Human NM_001085458.2

Homo sapiens catenin delta 1 (CTNND1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
CTNND1 (1500)
Length:
6670
CDS:
532..3438

Additional Resources:

NCBI RefSeq record:
NM_001085458.2
NBCI Gene record:
CTNND1 (1500)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001085458.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344830 ACTACCCTCCTGATGGTTATA pLKO_005 1151 CDS 100% 13.200 6.600 Y CTNND1 n/a
2 TRCN0000122988 CTCCCAATGTTGCCAACAATA pLKO.1 2342 CDS 100% 13.200 6.600 Y CTNND1 n/a
3 TRCN0000333450 CTCCCAATGTTGCCAACAATA pLKO_005 2342 CDS 100% 13.200 6.600 Y CTNND1 n/a
4 TRCN0000344770 GCTTCGAAAGGCTCGTGATAT pLKO_005 1908 CDS 100% 13.200 6.600 Y CTNND1 n/a
5 TRCN0000122987 CGCCACTATGAAGATGGTTAT pLKO.1 1174 CDS 100% 10.800 5.400 Y CTNND1 n/a
6 TRCN0000333514 CGCCACTATGAAGATGGTTAT pLKO_005 1174 CDS 100% 10.800 5.400 Y CTNND1 n/a
7 TRCN0000122985 GCTCCCAATGTTGCCAACAAT pLKO.1 2341 CDS 100% 5.625 2.813 Y CTNND1 n/a
8 TRCN0000122984 CCTGACTCAATTATTTGCATA pLKO.1 3673 3UTR 100% 4.950 2.475 Y CTNND1 n/a
9 TRCN0000122986 CGGATATACATCTCACTTCTT pLKO.1 2527 CDS 100% 4.950 2.475 Y CTNND1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001085458.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10760 pDONR223 100% 62.9% 62.7% None (many diffs) n/a
2 ccsbBroad304_10760 pLX_304 0% 62.9% 62.7% V5 (many diffs) n/a
3 TRCN0000466633 GGTACAGGGGAGCGGACCCTTTTA pLX_317 24.8% 62.9% 62.7% V5 (many diffs) n/a
Download CSV