Transcript: Human NM_001085481.3

Homo sapiens microtubule associated protein 1 light chain 3 beta 2 (MAP1LC3B2), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
MAP1LC3B2 (643246)
Length:
818
CDS:
155..532

Additional Resources:

NCBI RefSeq record:
NM_001085481.3
NBCI Gene record:
MAP1LC3B2 (643246)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001085481.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255658 AGATCGATCAGTTCATCTAAT pLKO_005 607 3UTR 100% 13.200 7.920 N MAP1LC3B2 n/a
2 TRCN0000255655 AGTAGAAGATGTCCGACTTAT pLKO_005 202 CDS 100% 13.200 6.600 Y MAP1LC3B2 n/a
3 TRCN0000153933 CAGCTTCCTGTTCTGGATAAA pLKO.1 281 CDS 100% 13.200 6.600 Y MAP1LC3B n/a
4 TRCN0000255654 GGATGAAATTGTCAGTGTAAA pLKO_005 513 CDS 100% 13.200 6.600 Y MAP1LC3B2 n/a
5 TRCN0000255656 TGAGTGAGCTCATCAAGATAA pLKO_005 333 CDS 100% 13.200 6.600 Y MAP1LC3B2 n/a
6 TRCN0000255657 CACCAATCTCAGAGGTGTATG pLKO_005 432 CDS 100% 10.800 5.400 Y MAP1LC3B2 n/a
7 TRCN0000154060 CGCTTACAGCTCAATGCTAAT pLKO.1 362 CDS 100% 10.800 5.400 Y MAP1LC3B n/a
8 TRCN0000153522 CCCGGTGATAATAGAACGATA pLKO.1 247 CDS 100% 4.950 2.475 Y MAP1LC3B n/a
9 TRCN0000151769 CGAACAAAGAGTAGAAGATGT pLKO.1 193 CDS 100% 4.950 2.475 Y MAP1LC3B n/a
10 TRCN0000155850 CGCACCTTCGAACAAAGAGTA pLKO.1 185 CDS 100% 4.950 2.475 Y MAP1LC3B n/a
11 TRCN0000152696 GAGGTGTATGAGAGTGAGAAA pLKO.1 443 CDS 100% 4.950 2.475 Y MAP1LC3B n/a
12 TRCN0000153286 GAGTAGAAGATGTCCGACTTA pLKO.1 201 CDS 100% 4.950 2.475 Y MAP1LC3B n/a
13 TRCN0000155417 CCTGACCATGTCAACATGAGT pLKO.1 317 CDS 100% 3.000 1.500 Y MAP1LC3B n/a
14 TRCN0000155416 CGACTTATTCGAGAGCAGCAT pLKO.1 215 CDS 100% 2.640 1.320 Y MAP1LC3B n/a
15 TRCN0000152948 GTTCGGGATGAAATTGTCAGT pLKO.1 508 CDS 100% 2.640 1.320 Y MAP1LC3B n/a
16 TRCN0000150377 CAAGATAATTAGAAGGCGCTT pLKO.1 346 CDS 100% 2.160 1.080 Y MAP1LC3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001085481.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04252 pDONR223 100% 99.4% 99.2% None 30G>C;338G>A n/a
2 ccsbBroad304_04252 pLX_304 0% 99.4% 99.2% V5 30G>C;338G>A n/a
3 TRCN0000467838 TCCCTATCTAGTACACCTACTGAA pLX_317 100% 99.4% 99.2% V5 30G>C;338G>A n/a
Download CSV