Transcript: Human NM_001097620.2

Homo sapiens transmembrane protein 184A (TMEM184A), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
TMEM184A (202915)
Length:
6051
CDS:
93..1334

Additional Resources:

NCBI RefSeq record:
NM_001097620.2
NBCI Gene record:
TMEM184A (202915)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001097620.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243151 CCTCCAGGCATTTGGCAAATA pLKO_005 698 CDS 100% 13.200 9.240 N TMEM184A n/a
2 TRCN0000243149 TACGAAGCCTTTGTCATTTAC pLKO_005 471 CDS 100% 13.200 9.240 N TMEM184A n/a
3 TRCN0000243150 TCAAGTTCCTCACCATCAAAG pLKO_005 859 CDS 100% 10.800 7.560 N TMEM184A n/a
4 TRCN0000181214 CAGTATCCTTCTCTGGGAGAT pLKO.1 3894 3UTR 100% 4.050 2.835 N TMEM184A n/a
5 TRCN0000243147 GGCTGTGGGAATCGCTCTTAT pLKO_005 2012 3UTR 100% 13.200 7.920 N TMEM184A n/a
6 TRCN0000243148 TCACCTGCCACCAGATCTATC pLKO_005 298 CDS 100% 10.800 6.480 N TMEM184A n/a
7 TRCN0000136382 CACCTGTAATTCCAGCACTTT pLKO.1 4373 3UTR 100% 4.950 2.475 Y CENPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001097620.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13395 pDONR223 100% 99.5% 99.2% None 53C>T;1166_1167insCGG;1168A>G n/a
2 ccsbBroad304_13395 pLX_304 0% 99.5% 99.2% V5 53C>T;1166_1167insCGG;1168A>G n/a
3 TRCN0000473308 CACAAAATAAATTTCGTTCTGTTT pLX_317 24% 99.5% 99.2% V5 53C>T;1166_1167insCGG;1168A>G n/a
Download CSV