Transcript: Mouse NM_001098170.1

Mus musculus protocadherin 10 (Pcdh10), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Pcdh10 (18526)
Length:
6064
CDS:
856..4029

Additional Resources:

NCBI RefSeq record:
NM_001098170.1
NBCI Gene record:
Pcdh10 (18526)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001098170.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424076 ACTCGTTCAGTAGTCACATTT pLKO_005 1715 CDS 100% 13.200 18.480 N Pcdh10 n/a
2 TRCN0000416569 GAAGATAGATCGCGAGCAAAT pLKO_005 1086 CDS 100% 10.800 15.120 N Pcdh10 n/a
3 TRCN0000094332 CCTTGCGAGACTACGAGATAA pLKO.1 1319 CDS 100% 13.200 10.560 N Pcdh10 n/a
4 TRCN0000094330 CCTCACACTTATCCTTATCAT pLKO.1 2994 CDS 100% 5.625 3.938 N Pcdh10 n/a
5 TRCN0000094331 GCCACGGTCAACATCTTGATA pLKO.1 2527 CDS 100% 5.625 3.938 N Pcdh10 n/a
6 TRCN0000094333 CCACAATCAGAACTATTGCTA pLKO.1 3297 CDS 100% 3.000 2.100 N Pcdh10 n/a
7 TRCN0000053555 GCGCAAGAAGAAACTCAGCAA pLKO.1 3186 CDS 100% 2.640 1.848 N PCDH10 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4399 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001098170.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08745 pDONR223 100% 87.8% 95% None (many diffs) n/a
2 ccsbBroad304_08745 pLX_304 0% 87.8% 95% V5 (many diffs) n/a
3 TRCN0000478590 GCCGAACCTAACTACTTGTCAGTT pLX_317 10.4% 87.8% 95% V5 (many diffs) n/a
Download CSV