Transcript: Mouse NM_001098226.3

Mus musculus TEA domain family member 3 (Tead3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tead3 (21678)
Length:
2452
CDS:
6..1403

Additional Resources:

NCBI RefSeq record:
NM_001098226.3
NBCI Gene record:
Tead3 (21678)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001098226.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085951 GTGCGAGTACATGATCAATTT pLKO.1 1196 CDS 100% 13.200 18.480 N Tead3 n/a
2 TRCN0000331521 GTGCGAGTACATGATCAATTT pLKO_005 1196 CDS 100% 13.200 18.480 N Tead3 n/a
3 TRCN0000085949 CCACGTCTACAAGCTTGTCAA pLKO.1 1376 CDS 100% 4.950 3.960 N Tead3 n/a
4 TRCN0000301919 CCACGTCTACAAGCTTGTCAA pLKO_005 1376 CDS 100% 4.950 3.960 N Tead3 n/a
5 TRCN0000085950 GAACGCTTTCTTCCTTGTCAA pLKO.1 968 CDS 100% 4.950 3.465 N Tead3 n/a
6 TRCN0000085952 CCGGACATCGAGCAGAGCTTT pLKO.1 192 CDS 100% 1.650 1.155 N Tead3 n/a
7 TRCN0000331522 CCGGACATCGAGCAGAGCTTT pLKO_005 192 CDS 100% 1.650 1.155 N Tead3 n/a
8 TRCN0000085948 GCCTCAAGTGACACCAGAATT pLKO.1 1647 3UTR 100% 0.000 0.000 N Tead3 n/a
9 TRCN0000301920 GCCTCAAGTGACACCAGAATT pLKO_005 1647 3UTR 100% 0.000 0.000 N Tead3 n/a
10 TRCN0000015948 GCCACTGTTCTGCGCTTTAAT pLKO.1 1556 3UTR 100% 15.000 21.000 N TEAD3 n/a
11 TRCN0000278042 GCCACTGTTCTGCGCTTTAAT pLKO_005 1556 3UTR 100% 15.000 21.000 N TEAD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001098226.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13966 pDONR223 100% 62.7% 67.9% None (many diffs) n/a
2 ccsbBroad304_13966 pLX_304 0% 62.7% 67.9% V5 (many diffs) n/a
3 TRCN0000472913 TCATACTTCACTGCCTTGGATCGC pLX_317 44.2% 62.7% 67.9% V5 (many diffs) n/a
Download CSV