Transcript: Human NM_001098721.1

Homo sapiens G protein subunit gamma 4 (GNG4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
GNG4 (2786)
Length:
4997
CDS:
329..556

Additional Resources:

NCBI RefSeq record:
NM_001098721.1
NBCI Gene record:
GNG4 (2786)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001098721.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008805 CGGGAAGATCCTCTCATCATT pLKO.1 476 CDS 100% 5.625 4.500 N GNG4 n/a
2 TRCN0000278013 CGGGAAGATCCTCTCATCATT pLKO_005 476 CDS 100% 5.625 4.500 N GNG4 n/a
3 TRCN0000008806 GCTAAAGATGGAAGCCTGTAT pLKO.1 394 CDS 100% 4.950 3.465 N GNG4 n/a
4 TRCN0000277951 GCTAAAGATGGAAGCCTGTAT pLKO_005 394 CDS 100% 4.950 3.465 N GNG4 n/a
5 TRCN0000008804 GCAGTAATATAAGGACCTGTT pLKO.1 1655 3UTR 100% 4.050 2.835 N GNG4 n/a
6 TRCN0000277950 GCAGTAATATAAGGACCTGTT pLKO_005 1655 3UTR 100% 4.050 2.835 N GNG4 n/a
7 TRCN0000008807 TCATCATTCCAGTGCCTGCAT pLKO.1 489 CDS 100% 2.640 1.848 N GNG4 n/a
8 TRCN0000277952 TCATCATTCCAGTGCCTGCAT pLKO_005 489 CDS 100% 2.640 1.848 N GNG4 n/a
9 TRCN0000008808 CCACTAGCATCTCCCAAGCCA pLKO.1 357 CDS 100% 0.250 0.175 N GNG4 n/a
10 TRCN0000286066 CCACTAGCATCTCCCAAGCCA pLKO_005 357 CDS 100% 0.250 0.175 N GNG4 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3712 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 1865 3UTR 100% 0.495 0.248 Y C11orf44 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3712 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001098721.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00657 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00657 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470212 ACCTGTCAGCCCGGTTGATGGGTA pLX_317 100% 100% 100% V5 n/a
Download CSV