Transcript: Mouse NM_001098789.1

Mus musculus NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2 (Ndufa4l2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ndufa4l2 (407790)
Length:
986
CDS:
44..307

Additional Resources:

NCBI RefSeq record:
NM_001098789.1
NBCI Gene record:
Ndufa4l2 (407790)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001098789.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254384 TCAGAGATCTCCACGTAAATC pLKO_005 309 3UTR 100% 13.200 18.480 N Ndufa4l2 n/a
2 TRCN0000254385 TTGCCGTTTCAACCGACTACA pLKO_005 255 CDS 100% 4.950 6.930 N Ndufa4l2 n/a
3 TRCN0000254382 CTGGGCTCATCCCAATGATTG pLKO_005 96 CDS 100% 10.800 8.640 N Ndufa4l2 n/a
4 TRCN0000254383 GAGTCCCAATGACCAGTACAA pLKO_005 229 CDS 100% 4.950 3.465 N Ndufa4l2 n/a
5 TRCN0000267615 GACTCTACTTGCTGCGACTTG pLKO_005 147 CDS 100% 4.050 2.835 N Ndufa4l2 n/a
6 TRCN0000046592 CTGCTGGGACAGAAAGAACAA pLKO.1 187 CDS 100% 4.950 2.970 N NDUFA4L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001098789.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03751 pDONR223 100% 88.8% 94.2% None (many diffs) n/a
2 ccsbBroad304_03751 pLX_304 0% 88.8% 94.2% V5 (many diffs) n/a
3 TRCN0000479559 CAGCCTTTGGTGACTGTGTGCTCA pLX_317 100% 88.8% 94.2% V5 (many diffs) n/a
Download CSV