Transcript: Human NM_001098808.1

Homo sapiens chromosome 9 open reading frame 129 (C9orf129), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
C9orf129 (445577)
Length:
1154
CDS:
365..955

Additional Resources:

NCBI RefSeq record:
NM_001098808.1
NBCI Gene record:
C9orf129 (445577)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001098808.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269886 ATGTCTGCTCACCTAACGTTT pLKO_005 825 CDS 100% 4.950 6.930 N C9orf129 n/a
2 TRCN0000269884 CAACTGACATTCCCTACTGAG pLKO_005 875 CDS 100% 4.050 5.670 N C9orf129 n/a
3 TRCN0000284117 GCCACTGACCACCATGTACAA pLKO_005 755 CDS 100% 4.950 3.465 N C9orf129 n/a
4 TRCN0000269887 GTACAAGGAAGGGATTCACAG pLKO_005 770 CDS 100% 4.050 2.835 N C9orf129 n/a
5 TRCN0000269885 GGCACTCTACTGAGGACAAAG pLKO_005 968 3UTR 100% 10.800 6.480 N C9orf129 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001098808.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07851 pDONR223 100% 14.6% 12.3% None (many diffs) n/a
2 ccsbBroad304_07851 pLX_304 0% 14.6% 12.3% V5 (many diffs) n/a
3 TRCN0000476487 TTGCCACTAGACTTATAACTTATA pLX_317 9.1% 14.6% 12.3% V5 (many diffs) n/a
4 ccsbBroadEn_02734 pDONR223 100% 14.6% 12.3% None (many diffs) n/a
5 ccsbBroad304_02734 pLX_304 0% 14.6% 12.3% V5 (many diffs) n/a
6 TRCN0000480694 ATACAGGGTGCACGCCTTGCGCGT pLX_317 13.6% 14.6% 12.3% V5 (many diffs) n/a
Download CSV