Transcript: Human NM_001099773.2

Homo sapiens cytochrome P450 family 11 subfamily A member 1 (CYP11A1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CYP11A1 (1583)
Length:
1986
CDS:
685..1776

Additional Resources:

NCBI RefSeq record:
NM_001099773.2
NBCI Gene record:
CYP11A1 (1583)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001099773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423133 GGAAGTGTTCACCACGATTAC pLKO_005 1084 CDS 100% 10.800 15.120 N CYP11A1 n/a
2 TRCN0000428238 CTTCACCTTCTGGCCCTTTAA pLKO_005 1734 CDS 100% 13.200 9.240 N CYP11A1 n/a
3 TRCN0000437510 GGCAACGTGGAGTCGGTTTAT pLKO_005 490 5UTR 100% 13.200 9.240 N CYP11A1 n/a
4 TRCN0000064275 GCGATTCATTGATGCCATCTA pLKO.1 903 CDS 100% 4.950 3.465 N CYP11A1 n/a
5 TRCN0000064277 GAAATCCAACACCTCAGCGAT pLKO.1 1666 CDS 100% 2.640 1.848 N CYP11A1 n/a
6 TRCN0000064273 CCAGAACTTCTACTGGGAATT pLKO.1 1053 CDS 100% 0.000 0.000 N CYP11A1 n/a
7 TRCN0000064276 GCTGAGCAAAGACAAGAACAT pLKO.1 1530 CDS 100% 4.950 2.970 N CYP11A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001099773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06077 pDONR223 100% 69.6% 69.6% None 0_1ins474 n/a
2 ccsbBroad304_06077 pLX_304 0% 69.6% 69.6% V5 0_1ins474 n/a
3 TRCN0000491577 TGTGCAATGTCACGCGCGTACGCT pLX_317 18.4% 69.6% 69.6% V5 (not translated due to prior stop codon) 0_1ins474 n/a
Download CSV