Transcript: Human NM_001100169.1

Homo sapiens inner membrane mitochondrial protein (IMMT), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
IMMT (10989)
Length:
3015
CDS:
389..2662

Additional Resources:

NCBI RefSeq record:
NM_001100169.1
NBCI Gene record:
IMMT (10989)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001100169.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125630 CCCGTTTCTATGCTGTTCAAA pLKO.1 2283 CDS 100% 5.625 7.875 N Immt n/a
2 TRCN0000323849 CCCGTTTCTATGCTGTTCAAA pLKO_005 2283 CDS 100% 5.625 7.875 N Immt n/a
3 TRCN0000136189 GCTAAGGTTGTATCTCAGTAT pLKO.1 1439 CDS 100% 4.950 6.930 N IMMT n/a
4 TRCN0000135616 GTCTAGAAATGAGCAGGTTTA pLKO.1 2752 3UTR 100% 10.800 8.640 N IMMT n/a
5 TRCN0000136244 GCACTATCCTATATGCCAAAT pLKO.1 567 CDS 100% 10.800 7.560 N IMMT n/a
6 TRCN0000137588 CCAAGCTTTAACCGCAGCTAT pLKO.1 2212 CDS 100% 4.950 3.465 N IMMT n/a
7 TRCN0000135198 CAGAAATAGCTTGTACCAGTA pLKO.1 2338 CDS 100% 4.050 2.835 N IMMT n/a
8 TRCN0000135307 CAAAGGAAATCAGCAGTGATA pLKO.1 2699 3UTR 100% 4.950 2.970 N IMMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001100169.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07719 pDONR223 100% 99.7% 99.7% None (many diffs) n/a
2 ccsbBroad304_07719 pLX_304 0% 99.7% 99.7% V5 (many diffs) n/a
3 TRCN0000470375 CCTGTACGACGGTCTCAATCCCGC pLX_317 21.6% 99.7% 99.7% V5 (many diffs) n/a
Download CSV