Transcript: Mouse NM_001101613.1

Mus musculus predicted gene 11567 (Gm11567), mRNA.

Source:
NCBI, updated 2017-01-31
Taxon:
Mus musculus (mouse)
Gene:
Gm11567 (670533)
Length:
1043
CDS:
52..639

Additional Resources:

NCBI RefSeq record:
NM_001101613.1
NBCI Gene record:
Gm11567 (670533)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001101613.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262084 GTTAACCTCCTGGTCCATTTC pLKO_005 800 3UTR 100% 10.800 8.640 N Gm11567 n/a
2 TRCN0000262082 TGGGTCTAACTGCTCCCAATC pLKO_005 609 CDS 100% 6.000 4.200 N Gm11567 n/a
3 TRCN0000262085 GCTCCCAATCTTGCTGTTGAT pLKO_005 620 CDS 100% 4.950 3.465 N Gm11567 n/a
4 TRCN0000262081 TGCTGTTGATAACTCTATCTC pLKO_005 631 CDS 100% 4.950 3.465 N Gm11567 n/a
5 TRCN0000262083 TCCCAAGGCTGTGGGTCTAAC pLKO_005 598 CDS 100% 3.600 2.160 N Gm11567 n/a
6 TRCN0000098437 GCTGGAGACCAAGCTGTGTGA pLKO.1 122 CDS 100% 0.880 0.440 Y Krtap9-1 n/a
7 TRCN0000098439 CCAGGTGCTGTATCTCCAGCT pLKO.1 413 CDS 100% 0.720 0.360 Y Krtap9-1 n/a
8 TRCN0000098438 CCAGCTGTTGTCAGTCCAGCT pLKO.1 323 CDS 100% 0.072 0.036 Y Krtap9-1 n/a
9 TRCN0000098435 AGCCTTGCTGTCAAACCACTT pLKO.1 197 CDS 100% 4.050 2.025 Y Krtap9-1 n/a
10 TRCN0000116660 CTGCTGTGTGTCCAGCTGCTT pLKO.1 285 CDS 100% 0.880 0.440 Y KRTAP4-2 n/a
11 TRCN0000098464 GCTGCTGCAAGCCCTGCTGTT pLKO.1 473 CDS 100% 0.000 0.000 Y Krtap5-1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001101613.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15184 pDONR223 61.6% 60.2% 48.1% None (many diffs) n/a
2 ccsbBroad304_15184 pLX_304 0% 60.2% 48.1% V5 (many diffs) n/a
3 TRCN0000476293 GATTTATAGACGAGAGCGAATCTG pLX_317 100% 37.2% 31.6% V5 (many diffs) n/a
4 TRCN0000479599 AGTGGAAAGGCTAATTTGGGTACC pLX_317 100% 37.2% 31.6% V5 (many diffs) n/a
Download CSV