Construct: ORF TRCN0000479599
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016891.2_s317c1
- Derived from:
- ccsbBroadEn_15184
- DNA Barcode:
- AGTGGAAAGGCTAATTTGGGTACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KRTAP9-2 (83899)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479599
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 100507608 | KRTAP9-6 | keratin associated protein 9-6 | NM_001277331.1 | 48.5% | 46.8% | (many diffs) |
| 2 | human | 85280 | KRTAP9-4 | keratin associated protein 9-4 | NM_033191.3 | 46.9% | 47.1% | (many diffs) |
| 3 | human | 83899 | KRTAP9-2 | keratin associated protein 9-2 | NM_031961.3 | 46.3% | 46.5% | 237C>T;244_522del |
| 4 | human | 81870 | KRTAP9-9 | keratin associated protein 9-9 | NM_001318227.1 | 45.4% | 44.8% | (many diffs) |
| 5 | human | 83900 | KRTAP9-3 | keratin associated protein 9-3 | NM_031962.3 | 44.7% | 43.9% | (many diffs) |
| 6 | human | 100507608 | KRTAP9-6 | keratin associated protein 9-6 | XM_003846481.1 | 44.6% | 43.1% | (many diffs) |
| 7 | human | 100505724 | KRTAP9-7 | keratin associated protein 9-7 | NM_001277332.1 | 42.9% | 42.5% | (many diffs) |
| 8 | human | 81870 | KRTAP9-9 | keratin associated protein 9-9 | NM_030975.2 | 42.5% | 41.9% | (many diffs) |
| 9 | human | 83901 | KRTAP9-8 | keratin associated protein 9-8 | NM_031963.3 | 41% | 42% | (many diffs) |
| 10 | human | 728318 | KRTAP9-1 | keratin associated protein 9-1 | NM_001190460.1 | 30.8% | 30.8% | (many diffs) |
| 11 | mouse | 16705 | Krtap9-1 | keratin associated protein 9-1 | NM_015741.2 | 38.9% | 33.1% | (many diffs) |
| 12 | mouse | 432600 | Gm11568 | predicted gene 11568 | XM_017314642.1 | 38.4% | 32.6% | (many diffs) |
| 13 | mouse | 100415785 | Gm11559 | predicted gene 11559 | NM_001177484.2 | 37.8% | 32.4% | (many diffs) |
| 14 | mouse | 670533 | Gm11567 | predicted gene 11567 | NM_001101613.1 | 37.2% | 31.6% | (many diffs) |
| 15 | mouse | 432600 | Gm11568 | predicted gene 11568 | XM_017314641.1 | 37% | 31.9% | (many diffs) |
| 16 | mouse | 432600 | Gm11568 | predicted gene 11568 | NM_001205030.1 | 33.9% | 29.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 93
- ORF end:
- 336
- ORF length:
- 243
- Sequence:
-
1 TCAGACAGTG GTTCAAAGTT TTTTTCTTCC ATTTCAGGTG TCGTGAGGCT AGCATCGATT 61 GATCAACAAG TTTGTACAAA AAAGTTGGCA CCATGACCCA CTGTTGCTCC CCTTGCTGTC 121 AGCCTACCTG CTGCAGGACC ACCTGCTGCA GGACCACCTG CTGGAAGCCC ACCACTGTGA 181 CCACCTGCAG CAGCACACCC TGCTGCCAGC CCGCCTGCTG TGTGTCCAGC TGCTGCCAGC 241 CTTGCTGCCG CCCAACTTGC TGTCAAAACA CCTGCTGTAG GACCACCTGC TGCCAGCCCA 301 CCTGTGTGAC CAGCTGCTGC CAGCCTTCTT GCTGCTTGCC AACTTTCTTG TACAAAGTGG 361 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 421 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 481 AAGTGGAAAG GCTAATTTGG GTACCACGCG TTAAGTCgac aatcaacctc tggattacaa 541 aatttgtgaa agatt