Transcript: Human NM_001102421.3

Homo sapiens zinc finger AN1-type containing 5 (ZFAND5), transcript variant b, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ZFAND5 (7763)
Length:
5704
CDS:
523..1164

Additional Resources:

NCBI RefSeq record:
NM_001102421.3
NBCI Gene record:
ZFAND5 (7763)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001102421.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350965 GATAGATACAGCCCTACAAAT pLKO_005 1340 3UTR 100% 13.200 18.480 N ZFAND5 n/a
2 TRCN0000007542 CCGTTACTCTGACAAGCACAA pLKO.1 1056 CDS 100% 4.050 5.670 N ZFAND5 n/a
3 TRCN0000338236 GAGAGCAGACACTAGCTTAAA pLKO_005 723 CDS 100% 13.200 10.560 N ZFAND5 n/a
4 TRCN0000007541 CTTGCCTGTAACTCAGCAAAT pLKO.1 804 CDS 100% 10.800 8.640 N ZFAND5 n/a
5 TRCN0000007540 CCCTCTTTAATTTCACAACAT pLKO.1 1611 3UTR 100% 4.950 3.960 N ZFAND5 n/a
6 TRCN0000007544 GCAGAAAGAAAGTTGGTCTTA pLKO.1 992 CDS 100% 4.950 3.960 N ZFAND5 n/a
7 TRCN0000216471 GGAATGTAATCAAGGTATAAT pLKO.1 1503 3UTR 100% 15.000 10.500 N Zfand5 n/a
8 TRCN0000240691 GGAATGTAATCAAGGTATAAT pLKO_005 1503 3UTR 100% 15.000 10.500 N Zfand5 n/a
9 TRCN0000338238 GCACAACTGTCCGTATGATTA pLKO_005 1071 CDS 100% 13.200 9.240 N ZFAND5 n/a
10 TRCN0000338237 TATGGAAATCCTAGGACAAAT pLKO_005 583 CDS 100% 13.200 9.240 N ZFAND5 n/a
11 TRCN0000338179 TTGACTGCCGATGTGGAAATT pLKO_005 1019 CDS 100% 13.200 9.240 N ZFAND5 n/a
12 TRCN0000007543 GAGCATTTCAAGAGAGGACAA pLKO.1 834 CDS 100% 4.050 2.835 N ZFAND5 n/a
13 TRCN0000165774 CCTCCTAAGTAGCTGGGATTA pLKO.1 3545 3UTR 100% 10.800 5.400 Y SNX29P1 n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3681 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3681 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001102421.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07175 pDONR223 100% 99.8% 100% None 153A>G n/a
2 ccsbBroad304_07175 pLX_304 0% 99.8% 100% V5 153A>G n/a
3 TRCN0000465572 GATCAGCCTGATCAAGTAATAAAT pLX_317 60.5% 99.8% 100% V5 153A>G n/a
Download CSV