Transcript: Mouse NM_001102565.1

Mus musculus alkB homolog 1, histone H2A dioxygenase (Alkbh1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Alkbh1 (211064)
Length:
1968
CDS:
16..1185

Additional Resources:

NCBI RefSeq record:
NM_001102565.1
NBCI Gene record:
Alkbh1 (211064)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001102565.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235018 GAAATACTCAGCAGATCATTA pLKO_005 561 CDS 100% 13.200 18.480 N ALKBH1 n/a
2 TRCN0000239212 GAAATACTCAGCAGATCATTA pLKO_005 561 CDS 100% 13.200 18.480 N Alkbh1 n/a
3 TRCN0000239216 TCACCCTGGGCTACCATTATA pLKO_005 527 CDS 100% 15.000 12.000 N Alkbh1 n/a
4 TRCN0000239214 CGAAGGCTATCCTGGATTTAT pLKO_005 294 CDS 100% 15.000 10.500 N Alkbh1 n/a
5 TRCN0000239213 ACCTCCTCCTAGTCGTCAAAT pLKO_005 1597 3UTR 100% 13.200 9.240 N Alkbh1 n/a
6 TRCN0000239215 GCCATCTGCATGACCCGAATA pLKO_005 1127 CDS 100% 10.800 7.560 N Alkbh1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001102565.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07312 pDONR223 100% 84.5% 82.7% None (many diffs) n/a
2 ccsbBroad304_07312 pLX_304 0% 84.5% 82.7% V5 (many diffs) n/a
3 TRCN0000472177 CGAGCACTATGCGCTCTGTGTCGC pLX_317 5.7% 84.5% 82.7% V5 (many diffs) n/a
Download CSV