Transcript: Mouse NM_001103158.2

Mus musculus zinc finger protein 980 (Zfp980), mRNA.

Source:
NCBI, updated 2017-05-08
Taxon:
Mus musculus (mouse)
Gene:
Zfp980 (100041379)
Length:
4003
CDS:
256..2193

Additional Resources:

NCBI RefSeq record:
NM_001103158.2
NBCI Gene record:
Zfp980 (100041379)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001103158.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272966 CAAATGCTTTACCCAACTTTC pLKO_005 942 CDS 100% 10.800 6.480 N Zfp980 n/a
2 TRCN0000239543 ACAGGAGAGAAACCTTATAAA pLKO_005 1663 CDS 100% 15.000 7.500 Y Gm13212 n/a
3 TRCN0000240280 CTCCGAAAGTACACCTTATAA pLKO_005 594 CDS 100% 15.000 7.500 Y Zfp600 n/a
4 TRCN0000240278 GCATGTTCTTAATCCTATAAT pLKO_005 3796 3UTR 100% 15.000 7.500 Y Zfp600 n/a
5 TRCN0000284687 TACAGGAGAGAAACCTTATAA pLKO_005 1662 CDS 100% 15.000 7.500 Y Zfp984 n/a
6 TRCN0000414126 ACCGAAAGAAGTCTTCTAAAT pLKO_005 542 CDS 100% 13.200 6.600 Y Rex2 n/a
7 TRCN0000429213 AGGAATGGGAATGTCTCAATT pLKO_005 374 CDS 100% 13.200 6.600 Y Rex2 n/a
8 TRCN0000273019 CAACCATCCCATCTTAGTATT pLKO_005 1207 CDS 100% 13.200 6.600 Y Zfp980 n/a
9 TRCN0000086300 CAGGAGAGAAACCTTACAAAT pLKO.1 992 CDS 100% 13.200 6.600 Y Znf41-ps n/a
10 TRCN0000235353 CAGGAGAGAAACCTTACAAAT pLKO_005 992 CDS 100% 13.200 6.600 Y EG666605 n/a
11 TRCN0000239788 CAGGAGAGACACCTTACAAAT pLKO_005 2333 3UTR 100% 13.200 6.600 Y Zfp985 n/a
12 TRCN0000084461 CCTCCGAAAGTACACCTTATA pLKO.1 593 CDS 100% 13.200 6.600 Y Rex2 n/a
13 TRCN0000416415 CTTACACTTGTGGTGAATTTG pLKO_005 836 CDS 100% 13.200 6.600 Y Rex2 n/a
14 TRCN0000431848 GATGTGATGTTGGAGAATTAC pLKO_005 418 CDS 100% 13.200 6.600 Y Rex2 n/a
15 TRCN0000273018 TCCGAAAGTACACCTTATAAC pLKO_005 595 CDS 100% 13.200 6.600 Y Zfp980 n/a
16 TRCN0000284909 TGTAATGAATGTGACAAATTC pLKO_005 2437 3UTR 100% 13.200 6.600 Y Zfp980 n/a
17 TRCN0000239789 TGTGACAAATGCTTTACTAAA pLKO_005 2530 3UTR 100% 13.200 6.600 Y Zfp985 n/a
18 TRCN0000429043 ACCTTACAAATGTAATGAATG pLKO_005 2343 3UTR 100% 10.800 5.400 Y Rex2 n/a
19 TRCN0000418910 ACCTTACAAATGTAGTGAATG pLKO_005 1002 CDS 100% 10.800 5.400 Y Rex2 n/a
20 TRCN0000431060 ATGTAGTGAATGCGACAAATG pLKO_005 1011 CDS 100% 10.800 5.400 Y Rex2 n/a
21 TRCN0000427418 GCCACTCTCCAATCCTCAAAC pLKO_005 631 CDS 100% 10.800 5.400 Y Rex2 n/a
22 TRCN0000240279 GTCAATGAGCATGGGCATAAC pLKO_005 523 CDS 100% 10.800 5.400 Y Zfp600 n/a
23 TRCN0000084460 CCCATCTTAGTATTCATCATA pLKO.1 962 CDS 100% 5.625 2.813 Y Rex2 n/a
24 TRCN0000084458 GCACATATAAAGACTGTGTAA pLKO.1 689 CDS 100% 4.950 2.475 Y Rex2 n/a
25 TRCN0000084459 GCAGAGAATTTATCCAGGAAA pLKO.1 894 CDS 100% 4.950 2.475 Y Rex2 n/a
26 TRCN0000239545 CCTTACAAATGTAGTGAATTT pLKO_005 1507 CDS 100% 13.200 6.600 Y Gm13212 n/a
27 TRCN0000240039 TGATGTTGGAGAATTACAATA pLKO_005 422 CDS 100% 13.200 6.600 Y Zfp991 n/a
28 TRCN0000421009 ATCCCATCTTAGTATTCATTG pLKO_005 1212 CDS 100% 10.800 5.400 Y Rex2 n/a
29 TRCN0000084462 CCAGGAAAGAAATCTTACAAA pLKO.1 907 CDS 100% 5.625 2.813 Y Rex2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001103158.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.