Transcript: Mouse NM_001103162.2

Mus musculus SREBF chaperone (Scap), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Scap (235623)
Length:
4138
CDS:
160..3990

Additional Resources:

NCBI RefSeq record:
NM_001103162.2
NBCI Gene record:
Scap (235623)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001103162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175061 GCGTACATCCAACAGATATTT pLKO.1 430 CDS 100% 15.000 21.000 N Scap n/a
2 TRCN0000341892 GCGTACATCCAACAGATATTT pLKO_005 430 CDS 100% 15.000 21.000 N Scap n/a
3 TRCN0000341895 CCATACCTGGTGGTCGTTATT pLKO_005 1207 CDS 100% 13.200 18.480 N Scap n/a
4 TRCN0000176040 GTCAAGTACGCTATTCCCTTT pLKO.1 3997 3UTR 100% 4.050 5.670 N Scap n/a
5 TRCN0000174611 GCTTAATGGTTCCCTTGATTT pLKO.1 3222 CDS 100% 13.200 9.240 N Scap n/a
6 TRCN0000341894 GCTTAATGGTTCCCTTGATTT pLKO_005 3222 CDS 100% 13.200 9.240 N Scap n/a
7 TRCN0000078064 GCTGCCATTGTCTGCAACTTT pLKO.1 3916 CDS 100% 5.625 3.938 N SCAP n/a
8 TRCN0000289278 GCTGCCATTGTCTGCAACTTT pLKO_005 3916 CDS 100% 5.625 3.938 N SCAP n/a
9 TRCN0000193825 CATCCTGTTTGCCTACATCTA pLKO.1 1038 CDS 100% 4.950 3.465 N Scap n/a
10 TRCN0000173997 CCATGGCGACATTACCTTGTA pLKO.1 2265 CDS 100% 4.950 3.465 N Scap n/a
11 TRCN0000341893 CCATGGCGACATTACCTTGTA pLKO_005 2265 CDS 100% 4.950 3.465 N Scap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001103162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11654 pDONR223 100% 61.2% 62.2% None (many diffs) n/a
2 ccsbBroad304_11654 pLX_304 0% 61.2% 62.2% V5 (many diffs) n/a
3 TRCN0000472230 TAGGTACTACCCCAAAGTACTAAA pLX_317 12.8% 61.2% 62.2% V5 (many diffs) n/a
Download CSV