Transcript: Mouse NM_001105252.1

Mus musculus transmembrane channel-like gene family 5 (Tmc5), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tmc5 (74424)
Length:
3774
CDS:
449..3352

Additional Resources:

NCBI RefSeq record:
NM_001105252.1
NBCI Gene record:
Tmc5 (74424)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001105252.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068913 GCTAATCATCACCTATCTTTA pLKO.1 3076 CDS 100% 13.200 18.480 N Tmc5 n/a
2 TRCN0000068914 CCAATTCTACAATCCGACATA pLKO.1 1860 CDS 100% 4.950 3.465 N Tmc5 n/a
3 TRCN0000068917 CCATGACAACTAGAGACAGAA pLKO.1 1410 CDS 100% 4.950 3.465 N Tmc5 n/a
4 TRCN0000068916 CCTTTGCATTTGGAGGAACTT pLKO.1 3272 CDS 100% 4.950 3.465 N Tmc5 n/a
5 TRCN0000068915 GCAGAAGAGATTCAAGGTCAT pLKO.1 1627 CDS 100% 4.050 2.835 N Tmc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001105252.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12628 pDONR223 100% 56.5% 57% None (many diffs) n/a
2 ccsbBroad304_12628 pLX_304 0% 56.5% 57% V5 (many diffs) n/a
3 TRCN0000478551 GTTTATTGTGAGATATCGAATTCC pLX_317 11.3% 56.5% 57% V5 (many diffs) n/a
Download CSV