Transcript: Mouse NM_001109905.2

Mus musculus staufen (RNA binding protein) homolog 1 (Drosophila) (Stau1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Stau1 (20853)
Length:
3607
CDS:
326..1795

Additional Resources:

NCBI RefSeq record:
NM_001109905.2
NBCI Gene record:
Stau1 (20853)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001109905.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313813 ATTGCGCTGAAGCGGAATTTG pLKO_005 635 CDS 100% 13.200 18.480 N Stau1 n/a
2 TRCN0000313812 GCCAAGGGATGAATCCTATTA pLKO_005 906 CDS 100% 13.200 10.560 N Stau1 n/a
3 TRCN0000313752 ACCTCAATAAATCGGAAATAA pLKO_005 600 CDS 100% 15.000 10.500 N Stau1 n/a
4 TRCN0000165690 CCAGGGATTCCAGGTTGAATA pLKO.1 1558 CDS 100% 13.200 9.240 N STAU1 n/a
5 TRCN0000102306 CCAGGTTGAATACAAAGATTT pLKO.1 1567 CDS 100% 13.200 9.240 N Stau1 n/a
6 TRCN0000317332 CCAGGTTGAATACAAAGATTT pLKO_005 1567 CDS 100% 13.200 9.240 N Stau1 n/a
7 TRCN0000102307 GCCAGAAAGGTTGGAGGTAAA pLKO.1 556 CDS 100% 10.800 7.560 N Stau1 n/a
8 TRCN0000102308 CCACCACACATGAAGAACTTT pLKO.1 689 CDS 100% 5.625 3.938 N Stau1 n/a
9 TRCN0000102309 CCCAGGGATTCCAGGTTGAAT pLKO.1 1557 CDS 100% 5.625 3.938 N Stau1 n/a
10 TRCN0000102305 GCTGGCTTCTTCAGATACTTT pLKO.1 2071 3UTR 100% 5.625 3.938 N Stau1 n/a
11 TRCN0000317335 GCTGGCTTCTTCAGATACTTT pLKO_005 2071 3UTR 100% 5.625 3.938 N Stau1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001109905.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01612 pDONR223 100% 73.8% 77.4% None (many diffs) n/a
2 ccsbBroad304_01612 pLX_304 0% 73.8% 77.4% V5 (many diffs) n/a
3 TRCN0000491368 GTCATTTTCATGCAGCTTGACGAA pLX_317 19.9% 73.8% 77.4% V5 (many diffs) n/a
Download CSV