Transcript: Mouse NM_001110504.1

Mus musculus calpain 1 (Capn1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Capn1 (12333)
Length:
3067
CDS:
92..2233

Additional Resources:

NCBI RefSeq record:
NM_001110504.1
NBCI Gene record:
Capn1 (12333)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001110504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030667 GCTCCATTAATATCTCCGATA pLKO.1 840 CDS 100% 4.050 5.670 N Capn1 n/a
2 TRCN0000030664 CGGATGTGAGTCTTGCCTAAT pLKO.1 2638 3UTR 100% 10.800 7.560 N Capn1 n/a
3 TRCN0000030665 GCCGTGGACTTTGACAACTTT pLKO.1 2093 CDS 100% 5.625 3.938 N Capn1 n/a
4 TRCN0000030668 CCGGAATTGGAATACCACATT pLKO.1 1180 CDS 100% 4.950 3.465 N Capn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001110504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00214 pDONR223 100% 85.8% 89.2% None (many diffs) n/a
2 ccsbBroad304_00214 pLX_304 0% 85.8% 89.2% V5 (many diffs) n/a
3 TRCN0000479881 GCCACTTTGTAGGCGCCATTCGAC pLX_317 19.1% 85.8% 89.2% V5 (many diffs) n/a
4 ccsbBroadEn_15373 pDONR223 0% 85.7% 89% None (many diffs) n/a
5 ccsbBroad304_15373 pLX_304 0% 85.7% 89% V5 (many diffs) n/a
Download CSV