Transcript: Human NM_001111061.2

Homo sapiens nescient helix-loop-helix 2 (NHLH2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
NHLH2 (4808)
Length:
2492
CDS:
497..904

Additional Resources:

NCBI RefSeq record:
NM_001111061.2
NBCI Gene record:
NHLH2 (4808)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001111061.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015054 CTGCTACATCTCCTATCTCAA pLKO.1 865 CDS 100% 4.950 6.930 N NHLH2 n/a
2 TRCN0000424496 CTGCTACATCTCCTATCTCAA pLKO_005 865 CDS 100% 4.950 6.930 N Nhlh2 n/a
3 TRCN0000015056 CCGCAAATTGCTGCCCACGCT pLKO.1 796 CDS 100% 0.000 0.000 N NHLH2 n/a
4 TRCN0000421568 ACTTTGAGTTCTCCTACATTC pLKO_005 1227 3UTR 100% 10.800 7.560 N NHLH2 n/a
5 TRCN0000424019 CAGAGTATGCAGGCTCATAAC pLKO_005 1293 3UTR 100% 10.800 7.560 N NHLH2 n/a
6 TRCN0000015053 CGTGTGATGAATTTAGCAAAT pLKO.1 2143 3UTR 100% 10.800 7.560 N NHLH2 n/a
7 TRCN0000015055 CGGCACGGACACCAAGGTGCT pLKO.1 571 CDS 100% 0.000 0.000 N NHLH2 n/a
8 TRCN0000015057 GCCATCTGCTACATCTCCTAT pLKO.1 860 CDS 100% 4.950 2.970 N NHLH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001111061.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01097 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01097 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476702 TCCATCAACGTTTCGGACATTGGT pLX_317 98.1% 100% 100% V5 n/a
Download CSV