Transcript: Mouse NM_001111102.2

Mus musculus lamin A (Lmna), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Lmna (16905)
Length:
2086
CDS:
250..1974

Additional Resources:

NCBI RefSeq record:
NM_001111102.2
NBCI Gene record:
Lmna (16905)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001111102.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350028 GCGGCTTGTGGAGATCGATAA pLKO_005 921 CDS 100% 10.800 15.120 N Lmna n/a
2 TRCN0000319563 CCACCGAAGTTCACCCTAAAG pLKO_005 1699 CDS 100% 10.800 8.640 N Lmna n/a
3 TRCN0000089852 CCCACCGAAGTTCACCCTAAA pLKO.1 1698 CDS 100% 10.800 8.640 N Lmna n/a
4 TRCN0000089850 GACGATCCTTTGATGACCTAT pLKO.1 1672 CDS 100% 4.950 3.960 N Lmna n/a
5 TRCN0000317672 GACGATCCTTTGATGACCTAT pLKO_005 1672 CDS 100% 4.950 3.960 N Lmna n/a
6 TRCN0000089849 CAGTATAAGAAGGAGCTAGAA pLKO.1 1021 CDS 100% 4.950 3.465 N Lmna n/a
7 TRCN0000089851 GCTTGACTTCCAGAAGAACAT pLKO.1 858 CDS 100% 4.950 3.465 N Lmna n/a
8 TRCN0000317749 GCTTGACTTCCAGAAGAACAT pLKO_005 858 CDS 100% 4.950 3.465 N Lmna n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001111102.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00945 pDONR223 100% 89.7% 97.2% None (many diffs) n/a
2 ccsbBroad304_00945 pLX_304 0% 89.7% 97.2% V5 (many diffs) n/a
3 TRCN0000479914 TCCACCGTTCTGGCCTTAGTTCCT pLX_317 26.4% 89.7% 97.2% V5 (many diffs) n/a
4 ccsbBroadEn_00946 pDONR223 100% 77.1% 82.9% None (many diffs) n/a
5 ccsbBroad304_00946 pLX_304 0% 77.1% 82.9% V5 (many diffs) n/a
6 TRCN0000478811 ACAATGAGTGTACATAATTTCCGT pLX_317 22.1% 77.1% 82.9% V5 (many diffs) n/a
Download CSV