Transcript: Human NM_001112724.2

Homo sapiens serine/threonine kinase 32A (STK32A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
STK32A (202374)
Length:
5333
CDS:
271..1461

Additional Resources:

NCBI RefSeq record:
NM_001112724.2
NBCI Gene record:
STK32A (202374)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145147 TCTGTTGCAGGTGATAACGC pXPR_003 AGG 326 27% 5 0.993 STK32A STK32A 76475
2 BRDN0001145029 ACGGCATATGAACTGCTGAG pXPR_003 AGG 650 55% 8 0.7341 STK32A STK32A 76474
3 BRDN0001146573 CATGAATAAACAAAAGTGCG pXPR_003 TGG 175 15% 4 0.2463 STK32A STK32A 76473
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001112724.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007130 GCAACAGAACGTCCACTTCAA pLKO.1 606 CDS 100% 4.950 6.930 N STK32A n/a
2 TRCN0000007127 GCACCCTTTCCTGGTTAATTT pLKO.1 507 CDS 100% 15.000 10.500 N STK32A n/a
3 TRCN0000195096 CGCAATGAAGTACATGAATAA pLKO.1 417 CDS 100% 13.200 9.240 N STK32A n/a
4 TRCN0000007128 GAGCGCAATGAAGTGAGAAAT pLKO.1 451 CDS 100% 13.200 9.240 N STK32A n/a
5 TRCN0000022822 GCGCATCATTCACAGGGATAT pLKO.1 690 CDS 100% 10.800 7.560 N Stk32a n/a
6 TRCN0000007131 TCCTGGTTAATTTGTGGTATT pLKO.1 515 CDS 100% 10.800 7.560 N STK32A n/a
7 TRCN0000007129 GAAGAATGATACCAAGAAGAT pLKO.1 393 CDS 100% 4.950 3.465 N STK32A n/a
8 TRCN0000196760 GATGTCAACTTTGACCACTTT pLKO.1 319 CDS 100% 4.950 3.465 N STK32A n/a
9 TRCN0000199618 GCTCTTCATCTGTGAGCTGGT pLKO.1 642 CDS 100% 2.160 1.512 N STK32A n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2874 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000165774 CCTCCTAAGTAGCTGGGATTA pLKO.1 2735 3UTR 100% 10.800 5.400 Y SNX29P1 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2874 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001112724.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09823 pDONR223 100% 41.2% 39.2% None (many diffs) n/a
2 ccsbBroad304_09823 pLX_304 0% 41.2% 39.2% V5 (many diffs) n/a
3 TRCN0000466743 TTGCGTGTGATGTTCCCACTTATC pLX_317 58.8% 41.2% 39.2% V5 (many diffs) n/a
4 ccsbBroadEn_15284 pDONR223 0% 41.2% 39.2% None (many diffs) n/a
5 ccsbBroad304_15284 pLX_304 0% 41.2% 39.2% V5 (many diffs) n/a
6 TRCN0000489951 TCAACAACCCATGATATTGCCACC pLX_317 95% 41.2% 39.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV