Transcript: Mouse NM_001112739.2

Mus musculus potassium voltage gated channel, Shaw-related subfamily, member 1 (Kcnc1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Kcnc1 (16502)
Length:
4336
CDS:
1211..2968

Additional Resources:

NCBI RefSeq record:
NM_001112739.2
NBCI Gene record:
Kcnc1 (16502)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001112739.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069436 CCATCGTGAACAAGACCGAAA pLKO.1 1860 CDS 100% 4.050 5.670 N Kcnc1 n/a
2 TRCN0000426396 TATTGTAAATCTGTCGTAAAC pLKO_005 2621 CDS 100% 10.800 8.640 N KCNC1 n/a
3 TRCN0000271807 TCCTCATGCGTGTCGTCTTCT pLKO_005 1989 CDS 100% 4.950 3.960 N Kcnc1 n/a
4 TRCN0000069437 AGCTGGGATCTCCCAATTATT pLKO.1 2604 CDS 100% 15.000 10.500 N Kcnc1 n/a
5 TRCN0000271853 CATCAAGAACTCCCTCAATAT pLKO_005 2029 CDS 100% 13.200 9.240 N Kcnc1 n/a
6 TRCN0000069435 CGCTCACATCCTGAACTATTA pLKO.1 1402 CDS 100% 13.200 9.240 N Kcnc1 n/a
7 TRCN0000426940 GCTAAGCAGAAACTACCAAAG pLKO_005 2552 CDS 100% 6.000 4.200 N KCNC1 n/a
8 TRCN0000069434 GCCATGGCTAAGCAGAAACTA pLKO.1 2546 CDS 100% 5.625 3.938 N Kcnc1 n/a
9 TRCN0000284528 CCACAGCCACTTCGACTATGA pLKO_005 1336 CDS 100% 4.950 3.465 N Kcnc1 n/a
10 TRCN0000069433 CCAGCGAACACACACACTTTA pLKO.1 2343 CDS 100% 13.200 7.920 N Kcnc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001112739.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06474 pDONR223 100% 80.8% 85.6% None (many diffs) n/a
2 ccsbBroad304_06474 pLX_304 0% 80.8% 85.6% V5 (many diffs) n/a
3 TRCN0000473296 TAAAAAATTATTCTTAATCTGTCA pLX_317 31.1% 80.8% 85.6% V5 (many diffs) n/a
Download CSV