Transcript: Human NM_001112741.2

Homo sapiens potassium voltage-gated channel subfamily C member 1 (KCNC1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
KCNC1 (3746)
Length:
4303
CDS:
1223..2980

Additional Resources:

NCBI RefSeq record:
NM_001112741.2
NBCI Gene record:
KCNC1 (3746)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001112741.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000284528 CCACAGCCACTTCGACTATGA pLKO_005 1348 CDS 100% 4.950 6.930 N Kcnc1 n/a
2 TRCN0000044813 CGTGAACAATTTCGGGATGTA pLKO.1 2527 CDS 100% 4.950 6.930 N KCNC1 n/a
3 TRCN0000437541 GCGCACATCCTGAACTACTAC pLKO_005 1415 CDS 100% 4.950 6.930 N KCNC1 n/a
4 TRCN0000069437 AGCTGGGATCTCCCAATTATT pLKO.1 2616 CDS 100% 15.000 10.500 N Kcnc1 n/a
5 TRCN0000044817 GCCCGTCATCGTGAACAATTT pLKO.1 2518 CDS 100% 13.200 9.240 N KCNC1 n/a
6 TRCN0000426396 TATTGTAAATCTGTCGTAAAC pLKO_005 2633 CDS 100% 10.800 7.560 N KCNC1 n/a
7 TRCN0000426940 GCTAAGCAGAAACTACCAAAG pLKO_005 2564 CDS 100% 6.000 4.200 N KCNC1 n/a
8 TRCN0000069434 GCCATGGCTAAGCAGAAACTA pLKO.1 2558 CDS 100% 5.625 3.938 N Kcnc1 n/a
9 TRCN0000044814 GCACACGCACTTTAAGAACAT pLKO.1 2362 CDS 100% 4.950 3.465 N KCNC1 n/a
10 TRCN0000044815 CATCGTGAACAAGACGGAGAT pLKO.1 1873 CDS 100% 4.050 2.835 N KCNC1 n/a
11 TRCN0000044816 GTTCATCAAGAACTCGCTCAA pLKO.1 2038 CDS 100% 4.050 2.835 N KCNC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001112741.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06474 pDONR223 100% 86.3% 85.8% None (many diffs) n/a
2 ccsbBroad304_06474 pLX_304 0% 86.3% 85.8% V5 (many diffs) n/a
3 TRCN0000473296 TAAAAAATTATTCTTAATCTGTCA pLX_317 31.1% 86.3% 85.8% V5 (many diffs) n/a
Download CSV