Transcript: Mouse NM_001113487.1

Mus musculus septin 9 (Sept9), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Sept9 (53860)
Length:
3796
CDS:
296..2026

Additional Resources:

NCBI RefSeq record:
NM_001113487.1
NBCI Gene record:
Sept9 (53860)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001113487.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077405 CCTCGGGAAGTCCACTTTAAT pLKO.1 1192 CDS 100% 15.000 21.000 N Sept9 n/a
2 TRCN0000331729 CCTCGGGAAGTCCACTTTAAT pLKO_005 1192 CDS 100% 15.000 21.000 N Sept9 n/a
3 TRCN0000077407 CGACCATGAGTATCAAGTCAA pLKO.1 1774 CDS 100% 4.950 3.960 N Sept9 n/a
4 TRCN0000301427 CGACCATGAGTATCAAGTCAA pLKO_005 1774 CDS 100% 4.950 3.960 N Sept9 n/a
5 TRCN0000077406 GCACTATCGAAGTTGAGAATA pLKO.1 1830 CDS 100% 13.200 9.240 N Sept9 n/a
6 TRCN0000301353 GCACTATCGAAGTTGAGAATA pLKO_005 1830 CDS 100% 13.200 9.240 N Sept9 n/a
7 TRCN0000077404 CCCATTATGAAGTTCATCAAT pLKO.1 1400 CDS 100% 5.625 3.938 N Sept9 n/a
8 TRCN0000301426 CCCATTATGAAGTTCATCAAT pLKO_005 1400 CDS 100% 5.625 3.938 N Sept9 n/a
9 TRCN0000077403 GCCAAGATATTCTGGTTACAT pLKO.1 2933 3UTR 100% 5.625 3.938 N Sept9 n/a
10 TRCN0000301425 GCCAAGATATTCTGGTTACAT pLKO_005 2933 3UTR 100% 5.625 3.938 N Sept9 n/a
11 TRCN0000058149 GCAGCCCATTATGAAGTTCAT pLKO.1 1396 CDS 100% 4.950 2.970 N TNFSF12 n/a
12 TRCN0000204191 GCAGCCCATTATGAAGTTCAT pLKO.1 1396 CDS 100% 4.950 2.970 N TNFSF12-TNFSF13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001113487.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07685 pDONR223 100% 83.7% 87.5% None (many diffs) n/a
2 ccsbBroad304_07685 pLX_304 0% 83.7% 87.5% V5 (many diffs) n/a
3 TRCN0000466954 CGCCCAAGTATTAATTACCCAGTC pLX_317 21.8% 83.7% 87.5% V5 (many diffs) n/a
Download CSV