Transcript: Human NM_001113495.1

Homo sapiens septin 9 (SEPTIN9), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
SEPTIN9 (10801)
Length:
3651
CDS:
277..1701

Additional Resources:

NCBI RefSeq record:
NM_001113495.1
NBCI Gene record:
SEPTIN9 (10801)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001113495.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119070 CAAGTCCATCACGCACGATAT pLKO.1 966 CDS 100% 10.800 15.120 N SEPTIN9 n/a
2 TRCN0000440381 TTCGACATGCTGCCAGGAAAC pLKO_005 1821 3UTR 100% 6.000 8.400 N SEPTIN9 n/a
3 TRCN0000119069 CCTGGACATCGAGTTTATGAA pLKO.1 1212 CDS 100% 5.625 7.875 N SEPTIN9 n/a
4 TRCN0000119071 CACGCACGATATTGAGGAGAA pLKO.1 975 CDS 100% 4.050 5.670 N SEPTIN9 n/a
5 TRCN0000119068 GCTTGGGTAAATCCACCTTAA pLKO.1 863 CDS 100% 10.800 8.640 N SEPTIN9 n/a
6 TRCN0000119067 CCTTCTCTGTAACCAGACTTT pLKO.1 3477 3UTR 100% 4.950 3.465 N SEPTIN9 n/a
7 TRCN0000445092 TCAACGGCAAGAGGATCCTTG pLKO_005 1463 CDS 100% 4.050 2.835 N SEPTIN9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001113495.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07685 pDONR223 100% 72.5% 55.2% None (many diffs) n/a
2 ccsbBroad304_07685 pLX_304 0% 72.5% 55.2% V5 (many diffs) n/a
3 TRCN0000466954 CGCCCAAGTATTAATTACCCAGTC pLX_317 21.8% 72.5% 55.2% V5 (many diffs) n/a
Download CSV