Transcript: Mouse NM_001114097.1

Mus musculus SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 (Smarcc2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Smarcc2 (68094)
Length:
4964
CDS:
92..3733

Additional Resources:

NCBI RefSeq record:
NM_001114097.1
NBCI Gene record:
Smarcc2 (68094)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001114097.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434077 AGCAACGCACCGCTTACTAAA pLKO_005 296 CDS 100% 13.200 18.480 N Smarcc2 n/a
2 TRCN0000426230 GACGCTGACAGACGAGGTAAA pLKO_005 916 CDS 100% 10.800 15.120 N Smarcc2 n/a
3 TRCN0000428494 GCAAGGTGTGAGGTGGAATAG pLKO_005 4190 3UTR 100% 10.800 15.120 N Smarcc2 n/a
4 TRCN0000085539 CCCAGGAGTATCTAACATCTA pLKO.1 1521 CDS 100% 4.950 6.930 N Smarcc2 n/a
5 TRCN0000085542 CCCGATAGTTGATCCTGAGAA pLKO.1 2539 CDS 100% 4.950 6.930 N Smarcc2 n/a
6 TRCN0000085541 CGACACATTCAACGAGTGGAT pLKO.1 826 CDS 100% 2.640 3.696 N Smarcc2 n/a
7 TRCN0000433947 GTGGATCCCAGCGAGTGAAAT pLKO_005 733 CDS 100% 13.200 10.560 N Smarcc2 n/a
8 TRCN0000085540 CCCAAACTGCTAGGGAAATTA pLKO.1 539 CDS 100% 15.000 10.500 N Smarcc2 n/a
9 TRCN0000413866 AGGACCCTCAACACCTTATAC pLKO_005 1045 CDS 100% 13.200 9.240 N Smarcc2 n/a
10 TRCN0000416801 GCCTGTCACGACCTAACATTT pLKO_005 498 CDS 100% 13.200 9.240 N Smarcc2 n/a
11 TRCN0000085538 CCCTTCAGAATTACTGCATTT pLKO.1 4021 3UTR 100% 10.800 7.560 N Smarcc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001114097.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06975 pDONR223 100% 79.7% 85.3% None (many diffs) n/a
2 ccsbBroad304_06975 pLX_304 0% 79.7% 85.3% V5 (many diffs) n/a
3 TRCN0000468652 TGATTTGTTTCGGCTACAATTTTA pLX_317 11.5% 79.7% 85.3% V5 (many diffs) n/a
Download CSV