Transcript: Mouse NM_001114541.1

Mus musculus PC-esterase domain containing 1A (Pced1a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Pced1a (319513)
Length:
2918
CDS:
167..1516

Additional Resources:

NCBI RefSeq record:
NM_001114541.1
NBCI Gene record:
Pced1a (319513)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001114541.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190249 CACTGTTTCGACGTCCTAGAT pLKO.1 836 CDS 100% 4.950 6.930 N Pced1a n/a
2 TRCN0000201990 CTTTGTACGAATGGACCAGGT pLKO.1 658 CDS 100% 2.160 3.024 N Pced1a n/a
3 TRCN0000202354 GATTGAGGACTGGTCAGAGAT pLKO.1 1015 CDS 100% 4.950 3.960 N Pced1a n/a
4 TRCN0000189985 GCCACGTTGTGTTCTGAACAA pLKO.1 1372 CDS 100% 4.950 3.960 N Pced1a n/a
5 TRCN0000129522 GCTGCTACACAACAAGTTCGT pLKO.1 250 CDS 100% 2.640 1.848 N PCED1A n/a
6 TRCN0000338668 GCTGCTACACAACAAGTTCGT pLKO_005 250 CDS 100% 2.640 1.848 N PCED1A n/a
7 TRCN0000131185 GCTACACAACAAGTTCGTGGT pLKO.1 253 CDS 100% 2.160 1.512 N PCED1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001114541.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03965 pDONR223 100% 86.6% 85.6% None (many diffs) n/a
2 ccsbBroad304_03965 pLX_304 0% 86.6% 85.6% V5 (many diffs) n/a
3 TRCN0000480929 CCAGCATTACTCGATATCGGTGCA pLX_317 28% 86.6% 85.6% V5 (many diffs) n/a
4 ccsbBroadEn_12488 pDONR223 100% 59.6% 59% None (many diffs) n/a
5 ccsbBroad304_12488 pLX_304 0% 59.6% 59% V5 (many diffs) n/a
6 TRCN0000471857 TTCTCTGACAGATAGAGAATCCTA pLX_317 42.7% 59.6% 59% V5 (many diffs) n/a
Download CSV