Transcript: Human NM_001122636.2

Homo sapiens polypeptide N-acetylgalactosaminyltransferase 9 (GALNT9), transcript variant A, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
GALNT9 (50614)
Length:
2933
CDS:
387..2198

Additional Resources:

NCBI RefSeq record:
NM_001122636.2
NBCI Gene record:
GALNT9 (50614)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001122636.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419113 ACGTACGGAGAGGTGAGAAAC pLKO_005 1776 CDS 100% 10.800 15.120 N GALNT9 n/a
2 TRCN0000035628 TGACTACTATGCCAAGCGCAA pLKO.1 1553 CDS 100% 2.160 3.024 N GALNT9 n/a
3 TRCN0000421096 ACCTAAGTCACACATCATAAT pLKO_005 2652 3UTR 100% 13.200 10.560 N GALNT9 n/a
4 TRCN0000035626 GCAGAAGTGGATGATCAGAAA pLKO.1 2153 CDS 100% 4.950 3.465 N GALNT9 n/a
5 TRCN0000035625 GCCCTACAACAACGACATTGA pLKO.1 1535 CDS 100% 4.950 3.465 N GALNT9 n/a
6 TRCN0000427991 GCTCCTTGTGGTCTGGTAAGA pLKO_005 2676 3UTR 100% 4.950 3.465 N GALNT9 n/a
7 TRCN0000419249 ATCAAACACGCACGGCACTGA pLKO_005 2178 CDS 100% 2.640 1.848 N GALNT9 n/a
8 TRCN0000035624 CCCGGAGATGAGGGTCTACAA pLKO.1 1745 CDS 100% 1.650 1.155 N GALNT9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001122636.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15056 pDONR223 92.9% 73% 63.5% None (many diffs) n/a
2 ccsbBroad304_15056 pLX_304 0% 73% 63.5% V5 (many diffs) n/a
3 TRCN0000477971 TAGAGTCTTGCCATAGGTCGCGAG pLX_317 11.6% 71.1% 63.8% V5 (many diffs) n/a
4 ccsbBroadEn_08178 pDONR223 100% 39.1% 39.3% None (many diffs) n/a
5 ccsbBroad304_08178 pLX_304 0% 39.1% 39.3% V5 (many diffs) n/a
6 TRCN0000468976 AGTCTGCCGCCATTTATGGACTAC pLX_317 53.8% 39.1% 39.3% V5 (many diffs) n/a
Download CSV