Transcript: Mouse NM_001122666.2

Mus musculus suppressor of defective silencing 3 homolog (S. cerevisiae) (Suds3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Suds3 (71954)
Length:
2333
CDS:
181..1179

Additional Resources:

NCBI RefSeq record:
NM_001122666.2
NBCI Gene record:
Suds3 (71954)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001122666.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039316 GTGGAGAGGAATTACATTAAA pLKO.1 550 CDS 100% 15.000 21.000 N Suds3 n/a
2 TRCN0000287548 GTGGAGAGGAATTACATTAAA pLKO_005 550 CDS 100% 15.000 21.000 N Suds3 n/a
3 TRCN0000294961 AGGACGCTGAACAAGCTTAAG pLKO_005 841 CDS 100% 10.800 15.120 N Suds3 n/a
4 TRCN0000038910 GCTCGGATAGAAGATGGCAAA pLKO.1 943 CDS 100% 4.050 3.240 N SUDS3 n/a
5 TRCN0000307474 GGTATGCTTTCCCGCCTAATC pLKO_005 1452 3UTR 100% 10.800 7.560 N Suds3 n/a
6 TRCN0000039318 CATTCCAGACAAGAGGAGAAA pLKO.1 762 CDS 100% 4.950 3.465 N Suds3 n/a
7 TRCN0000039314 GAACAGATGTATCAGGACAAA pLKO.1 388 CDS 100% 4.950 3.465 N Suds3 n/a
8 TRCN0000287550 GAACAGATGTATCAGGACAAA pLKO_005 388 CDS 100% 4.950 3.465 N Suds3 n/a
9 TRCN0000039317 CTACCTGGAATCTAAGGACAA pLKO.1 1005 CDS 100% 4.050 2.835 N Suds3 n/a
10 TRCN0000039315 CGAGAACGAGAAACTCACCAT pLKO.1 663 CDS 100% 2.640 1.848 N Suds3 n/a
11 TRCN0000287467 CGAGAACGAGAAACTCACCAT pLKO_005 663 CDS 100% 2.640 1.848 N Suds3 n/a
12 TRCN0000234395 ACAAGAGCCAGGCCATCTATC pLKO_005 989 CDS 100% 10.800 7.560 N SUDS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001122666.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12472 pDONR223 100% 44.8% 49.6% None (many diffs) n/a
2 ccsbBroad304_12472 pLX_304 0% 44.8% 49.6% V5 (many diffs) n/a
3 TRCN0000481353 CACAAACGCGCGGACCTATCTCGA pLX_317 85% 44.8% 49.6% V5 (many diffs) n/a
Download CSV