Transcript: Mouse NM_001122818.2

Mus musculus patatin-like phospholipase domain containing 6 (Pnpla6), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Pnpla6 (50767)
Length:
4502
CDS:
209..4246

Additional Resources:

NCBI RefSeq record:
NM_001122818.2
NBCI Gene record:
Pnpla6 (50767)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001122818.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000319441 CAGGTTGTGACCCGCCTTATT pLKO_005 2330 CDS 100% 13.200 18.480 N Pnpla6 n/a
2 TRCN0000106597 CCTATGAACGTGGACGGATAT pLKO.1 1449 CDS 100% 10.800 15.120 N Pnpla6 n/a
3 TRCN0000319442 CTATGAACGTGGACGGATATC pLKO_005 1450 CDS 100% 10.800 15.120 N Pnpla6 n/a
4 TRCN0000106596 CCCGCCTTATTCATCTGCTAA pLKO.1 2340 CDS 100% 4.950 6.930 N Pnpla6 n/a
5 TRCN0000319514 ACAACCTGCCAGCGGATATTG pLKO_005 3534 CDS 100% 13.200 9.240 N Pnpla6 n/a
6 TRCN0000106599 CCTGTATTGGACCTCACATAT pLKO.1 3263 CDS 100% 13.200 9.240 N Pnpla6 n/a
7 TRCN0000319516 CTGAGGAAGTGTGCCTATTTG pLKO_005 1821 CDS 100% 13.200 9.240 N Pnpla6 n/a
8 TRCN0000106595 CCTGTTCCTAGACTGGGTTAT pLKO.1 4265 3UTR 100% 10.800 7.560 N Pnpla6 n/a
9 TRCN0000317707 CCTGTTCCTAGACTGGGTTAT pLKO_005 4265 3UTR 100% 10.800 7.560 N Pnpla6 n/a
10 TRCN0000106598 GCCTGTATTGGACCTCACATA pLKO.1 3262 CDS 100% 4.950 3.465 N Pnpla6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001122818.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15730 pDONR223 0% 84.8% 94% None (many diffs) n/a
2 ccsbBroad304_15730 pLX_304 0% 84.8% 94% V5 (many diffs) n/a
3 TRCN0000473947 CACGTTCAACGGACCGGCACAGGT pLX_317 10.6% 84.8% 94% V5 (many diffs) n/a
4 ccsbBroadEn_02556 pDONR223 100% 84.7% 94.2% None (many diffs) n/a
5 ccsbBroad304_02556 pLX_304 0% 84.7% 94.2% V5 (many diffs) n/a
6 TRCN0000478679 ACAGCGTTTCCATTCTAGACGTAC pLX_317 8.4% 84.7% 94.2% V5 (many diffs) n/a
Download CSV