Transcript: Human NM_001123369.1

Homo sapiens protein phosphatase 6 catalytic subunit (PPP6C), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
PPP6C (5537)
Length:
4190
CDS:
222..1073

Additional Resources:

NCBI RefSeq record:
NM_001123369.1
NBCI Gene record:
PPP6C (5537)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001123369.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002766 CCAAAGTTATTCCGGGCAGTT pLKO.1 999 CDS 100% 4.050 5.670 N PPP6C n/a
2 TRCN0000002768 GCTTATTTACTGGTCTGGGAA pLKO.1 1351 3UTR 100% 2.640 3.696 N PPP6C n/a
3 TRCN0000279949 GCTTATTTACTGGTCTGGGAA pLKO_005 1351 3UTR 100% 2.640 3.696 N PPP6C n/a
4 TRCN0000379835 CTAGTGCACGAAGGCTATAAA pLKO_005 870 CDS 100% 0.000 0.000 N PPP6C n/a
5 TRCN0000379918 CTAAATGGCCTGATCGTATTA pLKO_005 457 CDS 100% 13.200 9.240 N PPP6C n/a
6 TRCN0000002767 GCTTCGATCATGGTCTTCAAA pLKO.1 960 CDS 100% 5.625 3.938 N PPP6C n/a
7 TRCN0000297274 GCTTCGATCATGGTCTTCAAA pLKO_005 960 CDS 100% 5.625 3.938 N PPP6C n/a
8 TRCN0000080924 GCCTGGAGATACTGTACCAAA pLKO.1 567 CDS 100% 4.950 3.465 N Ppp6c n/a
9 TRCN0000002764 GAGTCAAATGTTCAGCCAGTA pLKO.1 333 CDS 100% 4.050 2.835 N PPP6C n/a
10 TRCN0000279950 GAGTCAAATGTTCAGCCAGTA pLKO_005 333 CDS 100% 4.050 2.835 N PPP6C n/a
11 TRCN0000002765 CCAGAACGACAACGCCATATT pLKO.1 1045 CDS 100% 13.200 7.920 N PPP6C n/a
12 TRCN0000279890 CCAGAACGACAACGCCATATT pLKO_005 1045 CDS 100% 13.200 7.920 N PPP6C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001123369.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01270 pDONR223 100% 92.7% 92.7% None 170_171ins66 n/a
2 ccsbBroad304_01270 pLX_304 0% 92.7% 92.7% V5 170_171ins66 n/a
3 TRCN0000471947 TCAGAATCTGCTTTGTGTCTCCAA pLX_317 45.2% 92.7% 92.7% V5 170_171ins66 n/a
Download CSV