Transcript: Human NM_001127176.3

Homo sapiens maestro (MRO), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-04-16
Taxon:
Homo sapiens (human)
Gene:
MRO (83876)
Length:
5097
CDS:
102..890

Additional Resources:

NCBI RefSeq record:
NM_001127176.3
NBCI Gene record:
MRO (83876)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127176.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147552 GCAGTTCTTCTACGCAAATAA pLKO.1 860 CDS 100% 15.000 21.000 N MRO n/a
2 TRCN0000130957 CAGGTTAAGCAGACACGAGAT pLKO.1 663 CDS 100% 4.050 5.670 N MRO n/a
3 TRCN0000129619 CCTCCTGATCCATTTACAGGA pLKO.1 686 CDS 100% 0.264 0.370 N MRO n/a
4 TRCN0000147666 GCAGGTACACACTTTCTTTAA pLKO.1 1128 3UTR 100% 13.200 10.560 N MRO n/a
5 TRCN0000414995 GTATTTGCTATTGATACTTTG pLKO_005 1322 3UTR 100% 10.800 7.560 N MRO n/a
6 TRCN0000149115 GAATACAGCTTCCAGAGTGAA pLKO.1 780 CDS 100% 4.950 3.465 N MRO n/a
7 TRCN0000128908 GAAAGCTAACACATAGGGAAA pLKO.1 1671 3UTR 100% 4.050 2.835 N MRO n/a
8 TRCN0000131052 CCACTATCATCCAGAGATCCT pLKO.1 839 CDS 100% 2.640 1.848 N MRO n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4527 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4527 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127176.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09125 pDONR223 100% 88.3% 80.2% None (many diffs) n/a
2 ccsbBroad304_09125 pLX_304 0% 88.3% 80.2% V5 (many diffs) n/a
3 TRCN0000467637 TGAGCAAGTGAAACAAACTGTCTT pLX_317 48.5% 88.3% 80.2% V5 (many diffs) n/a
Download CSV