Transcript: Mouse NM_001127351.1

Mus musculus sirtuin 3 (Sirt3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Sirt3 (64384)
Length:
1439
CDS:
250..1023

Additional Resources:

NCBI RefSeq record:
NM_001127351.1
NBCI Gene record:
Sirt3 (64384)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001127351.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039332 GCCCAATGTCACTCACTACTT pLKO.1 438 CDS 100% 4.950 3.960 N Sirt3 n/a
2 TRCN0000332647 GCCCAATGTCACTCACTACTT pLKO_005 438 CDS 100% 4.950 3.960 N Sirt3 n/a
3 TRCN0000039330 GCGGCTCTATACACAGAACAT pLKO.1 492 CDS 100% 4.950 3.960 N Sirt3 n/a
4 TRCN0000306513 AGACAGCTCCAACACGTTTAC pLKO_005 1094 3UTR 100% 10.800 7.560 N Sirt3 n/a
5 TRCN0000039331 CCTACTCCATATGGCTGACTT pLKO.1 729 CDS 100% 0.000 0.000 N Sirt3 n/a
6 TRCN0000039333 CACAAGAACTGCTGGATCTTA pLKO.1 962 CDS 100% 5.625 3.375 N Sirt3 n/a
7 TRCN0000332648 CACAAGAACTGCTGGATCTTA pLKO_005 962 CDS 100% 5.625 3.375 N Sirt3 n/a
8 TRCN0000039329 GCCATCTTTGAACTTGGCTTT pLKO.1 355 CDS 100% 4.050 2.430 N Sirt3 n/a
9 TRCN0000332649 GCCATCTTTGAACTTGGCTTT pLKO_005 355 CDS 100% 4.050 2.430 N Sirt3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127351.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02761 pDONR223 98.6% 54% 55.1% None (many diffs) n/a
2 ccsbBroad304_02761 pLX_304 0% 54% 55.1% V5 (many diffs) n/a
Download CSV