Transcript: Human NM_001127442.2

Homo sapiens carboxypeptidase A5 (CPA5), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CPA5 (93979)
Length:
1842
CDS:
484..1695

Additional Resources:

NCBI RefSeq record:
NM_001127442.2
NBCI Gene record:
CPA5 (93979)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127442.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047043 GCCAATAAGATTGTCAGTGAT pLKO.1 1111 CDS 100% 4.950 6.930 N CPA5 n/a
2 TRCN0000047046 CGGAAGAACAAGTCCATCAGA pLKO.1 1243 CDS 100% 3.000 4.200 N CPA5 n/a
3 TRCN0000371833 CCCACAGCATGAACCGCTTAT pLKO_005 1220 CDS 100% 10.800 7.560 N CPA5 n/a
4 TRCN0000047044 GCATTCCGATATTGTCTCAAA pLKO.1 948 CDS 100% 4.950 3.465 N CPA5 n/a
5 TRCN0000047045 CGTTTCAAATCAGAGGGAGTT pLKO.1 1500 CDS 100% 4.050 2.835 N CPA5 n/a
6 TRCN0000047047 CTGTGGATATGAGAGTTCCTT pLKO.1 719 CDS 100% 3.000 2.100 N CPA5 n/a
7 TRCN0000371890 AGCTTCAGTTACTCATCATAC pLKO_005 880 CDS 100% 10.800 6.480 N CPA5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127442.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09363 pDONR223 100% 92.1% 80.4% None (many diffs) n/a
2 ccsbBroad304_09363 pLX_304 0% 92.1% 80.4% V5 (many diffs) n/a
3 TRCN0000469314 TGTTTTCCGGTAATCCACTCCGCC pLX_317 32.3% 92.1% 80.4% V5 (many diffs) n/a
4 ccsbBroadEn_16071 pDONR223 0% 92.1% 80.1% None (many diffs) n/a
5 ccsbBroad304_16071 pLX_304 0% 92.1% 80.1% V5 (many diffs) n/a
6 TRCN0000467135 GCCGCTTACCTCTTTAAGGCTCTA pLX_317 32.3% 92.1% 80.1% V5 (many diffs) n/a
Download CSV