Transcript: Human NM_001127605.3

Homo sapiens lipase A, lysosomal acid type (LIPA), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
LIPA (3988)
Length:
2526
CDS:
71..1270

Additional Resources:

NCBI RefSeq record:
NM_001127605.3
NBCI Gene record:
LIPA (3988)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127605.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029247 GCAGATGTCTACGACGTCAAT pLKO.1 1112 CDS 100% 4.950 6.930 N LIPA n/a
2 TRCN0000338649 GCAGATGTCTACGACGTCAAT pLKO_005 1112 CDS 100% 4.950 6.930 N LIPA n/a
3 TRCN0000029248 CAAGTGTATTATGTGGGTCAT pLKO.1 569 CDS 100% 4.050 5.670 N LIPA n/a
4 TRCN0000338648 CAAGTGTATTATGTGGGTCAT pLKO_005 569 CDS 100% 4.050 5.670 N LIPA n/a
5 TRCN0000350924 CAGTGTCTCAACCATAGTATT pLKO_005 1483 3UTR 100% 13.200 9.240 N LIPA n/a
6 TRCN0000029244 CCACGTTTGCACTCATGTCAT pLKO.1 805 CDS 100% 4.950 3.465 N LIPA n/a
7 TRCN0000029246 CCAGTTGTCTTCCTGCAACAT pLKO.1 308 CDS 100% 4.950 3.465 N LIPA n/a
8 TRCN0000029245 GCCAGGCTGTTAAATTCCAAA pLKO.1 960 CDS 100% 4.950 3.465 N LIPA n/a
9 TRCN0000350988 GCCAGGCTGTTAAATTCCAAA pLKO_005 960 CDS 100% 4.950 3.465 N LIPA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127605.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06525 pDONR223 100% 99.8% 99.4% None 46A>C;85G>T n/a
2 ccsbBroad304_06525 pLX_304 0% 99.8% 99.4% V5 46A>C;85G>T n/a
3 TRCN0000473921 TAAAAGACAAGCGTTTTCTGTTGT pLX_317 35.5% 99.8% 99.4% V5 46A>C;85G>T n/a
Download CSV