Transcript: Human NM_001127895.2

Homo sapiens carbohydrate sulfotransferase 8 (CHST8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CHST8 (64377)
Length:
2225
CDS:
508..1782

Additional Resources:

NCBI RefSeq record:
NM_001127895.2
NBCI Gene record:
CHST8 (64377)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127895.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035096 CGACTACGATTTCGTAGGCAA pLKO.1 1527 CDS 100% 0.264 0.370 N CHST8 n/a
2 TRCN0000035097 CGACTTCTACTACATGGATTA pLKO.1 1719 CDS 100% 10.800 8.640 N CHST8 n/a
3 TRCN0000291298 CGACTTCTACTACATGGATTA pLKO_005 1719 CDS 100% 10.800 8.640 N CHST8 n/a
4 TRCN0000035094 GCCAGGAATAAAGTTCAACAT pLKO.1 633 CDS 100% 4.950 3.465 N CHST8 n/a
5 TRCN0000291244 GCCAGGAATAAAGTTCAACAT pLKO_005 633 CDS 100% 4.950 3.465 N CHST8 n/a
6 TRCN0000035095 CCTGATGTTCAACTATTCCAA pLKO.1 1740 CDS 100% 3.000 2.100 N CHST8 n/a
7 TRCN0000307655 CCTGATGTTCAACTATTCCAA pLKO_005 1740 CDS 100% 3.000 2.100 N CHST8 n/a
8 TRCN0000035098 CCAGCACAACACCGTCCACTA pLKO.1 1173 CDS 100% 1.350 0.945 N CHST8 n/a
9 TRCN0000291296 CCAGCACAACACCGTCCACTA pLKO_005 1173 CDS 100% 1.350 0.945 N CHST8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127895.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03941 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03941 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480331 TGTGCCTCATCCAGAACCACGTAT pLX_317 29.7% 100% 100% V5 n/a
Download CSV