Transcript: Human NM_001127899.4

Homo sapiens chloride voltage-gated channel 5 (CLCN5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CLCN5 (1184)
Length:
10122
CDS:
661..3111

Additional Resources:

NCBI RefSeq record:
NM_001127899.4
NBCI Gene record:
CLCN5 (1184)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127899.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427059 CACCTATAGGTGGAGTATTAT pLKO_005 1640 CDS 100% 15.000 21.000 N CLCN5 n/a
2 TRCN0000043904 GCACCGAGAGATTACCAATAA pLKO.1 966 CDS 100% 13.200 18.480 N CLCN5 n/a
3 TRCN0000043907 GCTGGTGTATCTGTAGCCTTT pLKO.1 1615 CDS 100% 4.050 5.670 N CLCN5 n/a
4 TRCN0000069496 CGGATGACTGTTTCTCTTGTT pLKO.1 2416 CDS 100% 4.950 3.960 N Clcn5 n/a
5 TRCN0000352263 CGGATGACTGTTTCTCTTGTT pLKO_005 2416 CDS 100% 4.950 3.960 N Clcn5 n/a
6 TRCN0000414058 TTCATTCTGCTGGGCATATTT pLKO_005 1834 CDS 100% 15.000 10.500 N CLCN5 n/a
7 TRCN0000043905 GCTTTAACACTCATACTGAAA pLKO.1 2164 CDS 100% 4.950 3.465 N CLCN5 n/a
8 TRCN0000043903 GCCAAAGAAGAGTTTGCTCAT pLKO.1 2584 CDS 100% 4.050 2.835 N CLCN5 n/a
9 TRCN0000043906 CCATGAACATTGTTGCTGGAA pLKO.1 1161 CDS 100% 2.640 1.848 N CLCN5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127899.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00322 pDONR223 100% 91.3% 91.4% None 1_210del;819A>G n/a
2 ccsbBroad304_00322 pLX_304 0% 91.3% 91.4% V5 1_210del;819A>G n/a
3 TRCN0000480726 CTTCCATCTTGATATGAGCGCTCT pLX_317 17.9% 91.3% 91.4% V5 1_210del;819A>G n/a
Download CSV