Transcript: Human NM_001128427.2

Homo sapiens follistatin like 5 (FSTL5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-23
Taxon:
Homo sapiens (human)
Gene:
FSTL5 (56884)
Length:
4832
CDS:
437..2977

Additional Resources:

NCBI RefSeq record:
NM_001128427.2
NBCI Gene record:
FSTL5 (56884)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001128427.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053322 GCAGACAGTAATGGACTTGTA pLKO.1 998 CDS 100% 4.950 6.930 N FSTL5 n/a
2 TRCN0000372337 CACCAACACTACAGGTAATTA pLKO_005 2136 CDS 100% 15.000 12.000 N FSTL5 n/a
3 TRCN0000372284 TCTAATGAGATTGCGACATAA pLKO_005 541 CDS 100% 13.200 10.560 N FSTL5 n/a
4 TRCN0000372282 CCTAGATGGACGACTCAATAA pLKO_005 2893 CDS 100% 13.200 9.240 N FSTL5 n/a
5 TRCN0000372283 GGGAATTTCAGATGACATAAA pLKO_005 3282 3UTR 100% 13.200 9.240 N FSTL5 n/a
6 TRCN0000053320 CCAACCAAAGAAGGAGGATAT pLKO.1 500 CDS 100% 10.800 7.560 N FSTL5 n/a
7 TRCN0000053319 GCAAGCAGAATGTGCCTGTAT pLKO.1 682 CDS 100% 4.950 3.465 N FSTL5 n/a
8 TRCN0000053318 GCTAACATATTATGGAGAGAA pLKO.1 1748 CDS 100% 4.950 3.465 N FSTL5 n/a
9 TRCN0000200667 GCTAACATATTATGGAGAGAA pLKO.1 1748 CDS 100% 4.950 3.465 N Fstl5 n/a
10 TRCN0000053321 CCAACTTTGGACAGAGTCCTT pLKO.1 1988 CDS 100% 2.640 1.848 N FSTL5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001128427.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08651 pDONR223 100% 99.8% 99.6% None 124_125insAGC;1696A>T;1888C>A n/a
2 ccsbBroad304_08651 pLX_304 0% 99.8% 99.6% V5 124_125insAGC;1696A>T;1888C>A n/a
Download CSV