Transcript: Human NM_001128616.2

Homo sapiens Rho guanine nucleotide exchange factor 3 (ARHGEF3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ARHGEF3 (50650)
Length:
4053
CDS:
605..2203

Additional Resources:

NCBI RefSeq record:
NM_001128616.2
NBCI Gene record:
ARHGEF3 (50650)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001128616.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412805 CTATTACCCTGTGTTGTATTT pLKO_005 2401 3UTR 100% 13.200 18.480 N ARHGEF3 n/a
2 TRCN0000047543 GCCTAGTAATAAACGGGTCAA pLKO.1 721 CDS 100% 4.050 5.670 N ARHGEF3 n/a
3 TRCN0000430081 GAATCTGAATGCCGCTATTAT pLKO_005 1541 CDS 100% 15.000 10.500 N ARHGEF3 n/a
4 TRCN0000437024 CCCTCTGCTTCTCCGAGAAAT pLKO_005 1420 CDS 100% 13.200 9.240 N ARHGEF3 n/a
5 TRCN0000047547 CCCATGCTGAAACTCTCCATA pLKO.1 1073 CDS 100% 4.950 3.465 N ARHGEF3 n/a
6 TRCN0000047546 CGCAAACTAGATCTCTGGAAT pLKO.1 1364 CDS 100% 4.950 3.465 N ARHGEF3 n/a
7 TRCN0000047545 GCGATCTTTGAGCTTTCCCAA pLKO.1 998 CDS 100% 2.640 1.848 N ARHGEF3 n/a
8 TRCN0000047544 CGGCTTCTTTACTTGGAAGAA pLKO.1 1568 CDS 100% 0.495 0.347 N ARHGEF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001128616.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03149 pDONR223 100% 94.4% 92.1% None (many diffs) n/a
2 ccsbBroad304_03149 pLX_304 0% 94.4% 92.1% V5 (many diffs) n/a
3 TRCN0000476018 ACGGCTAGCTGTTATCGGGTACTC pLX_317 24.4% 94.4% 92.1% V5 (many diffs) n/a
4 ccsbBroadEn_11925 pDONR223 100% 60.5% 60.3% None 1_627delinsA;629_630insAA;1021T>G n/a
5 ccsbBroad304_11925 pLX_304 0% 60.5% 60.3% V5 1_627delinsA;629_630insAA;1021T>G n/a
6 TRCN0000474076 TTTTGCCACTACTCGGCCACGTTG pLX_317 39.2% 60.5% 60.3% V5 1_627delinsA;629_630insAA;1021T>G n/a
Download CSV