Construct: ORF TRCN0000474076
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002977.1_s317c1
- Derived from:
- ccsbBroadEn_11925
- DNA Barcode:
- TTTTGCCACTACTCGGCCACGTTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ARHGEF3 (50650)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474076
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 50650 | ARHGEF3 | Rho guanine nucleotide exch... | XM_011533767.1 | 78.1% | 77.9% | 1_267delinsA;269_270insAA;661T>G |
| 2 | human | 50650 | ARHGEF3 | Rho guanine nucleotide exch... | NM_019555.3 | 61.2% | 61% | 1_609delinsA;611_612insAA;1003T>G |
| 3 | human | 50650 | ARHGEF3 | Rho guanine nucleotide exch... | XM_011533765.1 | 61.1% | 60.9% | 1_612delinsA;614_615insAA;1006T>G |
| 4 | human | 50650 | ARHGEF3 | Rho guanine nucleotide exch... | XM_011533766.2 | 61.1% | 60.9% | 1_612delinsA;614_615insAA;1006T>G |
| 5 | human | 50650 | ARHGEF3 | Rho guanine nucleotide exch... | NM_001128616.2 | 60.5% | 60.3% | 1_627delinsA;629_630insAA;1021T>G |
| 6 | human | 50650 | ARHGEF3 | Rho guanine nucleotide exch... | NM_001289698.2 | 60.5% | 60.3% | 1_627delinsA;629_630insAA;1021T>G |
| 7 | human | 50650 | ARHGEF3 | Rho guanine nucleotide exch... | XM_017006502.1 | 59.9% | 59.6% | 1_645delinsA;647_648insAA;1039T>G |
| 8 | human | 50650 | ARHGEF3 | Rho guanine nucleotide exch... | XM_024453546.1 | 59.9% | 59.6% | 1_645delinsA;647_648insAA;1039T>G |
| 9 | human | 50650 | ARHGEF3 | Rho guanine nucleotide exch... | XM_024453547.1 | 59.9% | 59.6% | 1_645delinsA;647_648insAA;1039T>G |
| 10 | human | 50650 | ARHGEF3 | Rho guanine nucleotide exch... | XM_011533764.1 | 59.2% | 59% | 1_663delinsA;665_666insAA;1057T>G |
| 11 | human | 50650 | ARHGEF3 | Rho guanine nucleotide exch... | NM_001128615.2 | 57.7% | 57.5% | 1_705delinsA;707_708insAA;1099T>G |
| 12 | human | 50650 | ARHGEF3 | Rho guanine nucleotide exch... | XM_005265186.5 | 57.7% | 57.5% | 1_705delinsA;707_708insAA;1099T>G |
| 13 | human | 50650 | ARHGEF3 | Rho guanine nucleotide exch... | XM_005265187.3 | 57.7% | 57.5% | 1_705delinsA;707_708insAA;1099T>G |
| 14 | human | 50650 | ARHGEF3 | Rho guanine nucleotide exch... | XM_017006505.1 | 47% | 37.2% | (many diffs) |
| 15 | human | 50650 | ARHGEF3 | Rho guanine nucleotide exch... | XM_017006506.2 | 46.4% | 36.8% | (many diffs) |
| 16 | human | 50650 | ARHGEF3 | Rho guanine nucleotide exch... | XM_017006504.1 | 45.9% | 36.4% | (many diffs) |
| 17 | human | 50650 | ARHGEF3 | Rho guanine nucleotide exch... | XM_017006503.1 | 44.3% | 35.1% | (many diffs) |
| 18 | mouse | 71704 | Arhgef3 | Rho guanine nucleotide exch... | XM_006519580.3 | 75.3% | 80.5% | (many diffs) |
| 19 | mouse | 71704 | Arhgef3 | Rho guanine nucleotide exch... | NM_001289687.1 | 53.8% | 57.5% | (many diffs) |
| 20 | mouse | 71704 | Arhgef3 | Rho guanine nucleotide exch... | NM_001289688.1 | 53.2% | 56.8% | (many diffs) |
| 21 | mouse | 71704 | Arhgef3 | Rho guanine nucleotide exch... | NM_027871.2 | 53.1% | 56.7% | (many diffs) |
| 22 | mouse | 71704 | Arhgef3 | Rho guanine nucleotide exch... | XM_006519576.3 | 52.3% | 55.9% | (many diffs) |
| 23 | mouse | 71704 | Arhgef3 | Rho guanine nucleotide exch... | NM_001289686.1 | 51.2% | 54.7% | (many diffs) |
| 24 | mouse | 71704 | Arhgef3 | Rho guanine nucleotide exch... | XM_006519574.3 | 51.2% | 54.7% | (many diffs) |
| 25 | mouse | 71704 | Arhgef3 | Rho guanine nucleotide exch... | XM_006519575.3 | 51.2% | 54.7% | (many diffs) |
| 26 | mouse | 71704 | Arhgef3 | Rho guanine nucleotide exch... | XM_006519579.3 | 51.2% | 54.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1041
- ORF length:
- 972
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaagctccct tgcctcagct cctatgatag ctactgcagc aatcaagtag 121 ccgccaaagc tctgctggac cacaaaaagc aagatcaccg agtccaggat ttcctacagc 181 gatgtttaga atcccccttt agccgcaaac tagatctctg gaatttcctc gatattccaa 241 gaagccgcct ggtaaaatac cctctgcttc tccgagaaat cttgaggcac acaccaaatg 301 ataatccaga tcagcagcac ttggaagaag ctataaatat cattcaggga attgtggcag 361 aaatcaacac caagactggt gaatctgaat gccgctatta taaagagcgg cttctttact 421 tggaagaagg ccagaaagac tccctgatcg acagctctcg agtcgtgtgt tgtcatggtg 481 aactgaagaa caatcggggc gtgaaactgc atgttttcct gttccaagaa gtgcttgtga 541 tcactcgagc cgtcacccac aatgagcagc tttgctacca gctgtaccgt cagccaatcc 601 ccgtgaaaga cctcctgctg gaagacctcc aggatggaga agtgaggctg ggtggctccc 661 TGCGAGGGGC ATTCAGCAAC AATGAGAGAA TTAAAAACTT CTTCAGAGTC AGTTTCAAAA 721 ATGGATCCCA AAGTCAGACC CACTCGCTAC AAGCCAATGA CACTTTCAAC AAACAGCAGT 781 GGCTTAACTG TATTCGTCAA GCCAAAGAAA CAGTTTTGTG TGCTGCCGGG CAAGCTGGGG 841 TGCTTGACTC CGAGGGATCG TTCCTAAATC CCACCACCGG GAGCAGAGAG CTACAGGGAG 901 AAACAAAACT TGAGCAGATG GACCAATCGG ACAGTGAGTC AGACTGTAGT ATGGACACGA 961 GTGAGGTCAG CCTCGACTGT GAGCGCATGG AACAGACAGA CTCTTCCTGT GGAAACAGCA 1021 GGCACGGTGA AAGTAACGTC TTGCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1081 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1141 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATTTT GCCACTACTC 1201 GGCCACGTTG ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt