Transcript: Human NM_001128834.2

Homo sapiens proteolipid protein 1 (PLP1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
PLP1 (5354)
Length:
3152
CDS:
286..1119

Additional Resources:

NCBI RefSeq record:
NM_001128834.2
NBCI Gene record:
PLP1 (5354)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001128834.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414394 TAGGACATCCCGACAAGTTTG pLKO_005 722 CDS 100% 10.800 15.120 N PLP1 n/a
2 TRCN0000084074 CTTACAACTTTGCCGTCCTTA pLKO.1 1070 CDS 100% 4.950 3.960 N PLP1 n/a
3 TRCN0000084077 GCAGATCTTTGGCGACTACAA pLKO.1 579 CDS 100% 4.950 3.960 N PLP1 n/a
4 TRCN0000424960 GAGAGTCTTGCAGTGATTAAG pLKO_005 1254 3UTR 100% 13.200 9.240 N PLP1 n/a
5 TRCN0000445598 GAGCGGGTGTGTCATTGTTTG pLKO_005 691 CDS 100% 10.800 7.560 N PLP1 n/a
6 TRCN0000084075 GACTATGAGTATCTCATCAAT pLKO.1 454 CDS 100% 5.625 3.938 N PLP1 n/a
7 TRCN0000090337 GCCAACATCAAGCTCATTCTT pLKO.1 668 CDS 100% 5.625 3.938 N Plp1 n/a
8 TRCN0000084073 CCTCTGTCATATCTTCACAAT pLKO.1 2085 3UTR 100% 4.950 3.465 N PLP1 n/a
9 TRCN0000084076 CCTTCATGATTGCTGCCACTT pLKO.1 1052 CDS 100% 4.050 2.835 N PLP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001128834.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06740 pDONR223 100% 87.2% 87.3% None 348_452del;609T>C n/a
2 ccsbBroad304_06740 pLX_304 0% 87.2% 87.3% V5 348_452del;609T>C n/a
3 TRCN0000466453 AAAATTTTCTGTCCTGACGAACGA pLX_317 58.1% 87.2% 87.3% V5 348_452del;609T>C n/a
Download CSV