Transcript: Human NM_001129900.1

Homo sapiens KRAB box domain containing 4 (KRBOX4), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
KRBOX4 (55634)
Length:
2487
CDS:
300..581

Additional Resources:

NCBI RefSeq record:
NM_001129900.1
NBCI Gene record:
KRBOX4 (55634)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001129900.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018206 GCGGTCAAGAATCCAGAACAT pLKO.1 684 3UTR 100% 4.950 6.930 N KRBOX4 n/a
2 TRCN0000018205 GCATTTATCTGAGCACAGAAT pLKO.1 714 3UTR 100% 4.950 3.465 N KRBOX4 n/a
3 TRCN0000018203 GCACAGAATTTGATTCTGTAA pLKO.1 726 3UTR 100% 0.495 0.347 N KRBOX4 n/a
4 TRCN0000018204 CCAAGACAAACTTCCTTGGCA pLKO.1 625 3UTR 100% 0.075 0.053 N KRBOX4 n/a
5 TRCN0000422599 TTGCGAAGCCAGATGTGATCT pLKO_005 451 CDS 100% 4.950 2.970 N KRBOX4 n/a
6 TRCN0000421351 TGAAGGATGAAAGCGGTCAAG pLKO_005 672 3UTR 100% 4.050 2.430 N KRBOX4 n/a
7 TRCN0000429161 TGAAGAGTCCTGGATGGCAGA pLKO_005 488 CDS 100% 2.160 1.296 N KRBOX4 n/a
8 TRCN0000414498 AGGACGTGTTTGTGGACTTCA pLKO_005 331 CDS 100% 4.950 2.475 Y KRBOX4 n/a
9 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 1705 3UTR 100% 4.950 2.475 Y LOC387873 n/a
10 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 1669 3UTR 100% 4.950 2.475 Y n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1742 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 1505 3UTR 100% 0.495 0.248 Y C11orf44 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1742 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001129900.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03615 pDONR223 100% 94.8% 94.8% None 235_236insCAGGTGAGGACAGGC n/a
2 ccsbBroad304_03615 pLX_304 0% 94.8% 94.8% V5 235_236insCAGGTGAGGACAGGC n/a
3 TRCN0000465876 GATCCTCACGCCACGCATGCATTA pLX_317 100% 94.8% 94.8% V5 235_236insCAGGTGAGGACAGGC n/a
Download CSV