Transcript: Mouse NM_001130008.1

Mus musculus G1 to S phase transition 1 (Gspt1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Gspt1 (14852)
Length:
6853
CDS:
329..2236

Additional Resources:

NCBI RefSeq record:
NM_001130008.1
NBCI Gene record:
Gspt1 (14852)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001130008.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088090 CCTGTATCGAAGAAGTCGAAA pLKO.1 1989 CDS 100% 4.950 6.930 N Gspt1 n/a
2 TRCN0000309362 CCTGTATCGAAGAAGTCGAAA pLKO_005 1989 CDS 100% 4.950 6.930 N Gspt1 n/a
3 TRCN0000088091 CCCAAGAAGGAACATGTAAAT pLKO.1 944 CDS 100% 13.200 9.240 N Gspt1 n/a
4 TRCN0000309294 CCCAAGAAGGAACATGTAAAT pLKO_005 944 CDS 100% 13.200 9.240 N Gspt1 n/a
5 TRCN0000088092 GCAACGAGAGATATGAAGAAT pLKO.1 1425 CDS 100% 5.625 3.938 N Gspt1 n/a
6 TRCN0000309360 GCAACGAGAGATATGAAGAAT pLKO_005 1425 CDS 100% 5.625 3.938 N Gspt1 n/a
7 TRCN0000118017 CCTGCACAATACTGTGAGGAA pLKO.1 2253 3UTR 100% 2.640 1.848 N GSPT1 n/a
8 TRCN0000291232 CCTGCACAATACTGTGAGGAA pLKO_005 2253 3UTR 100% 2.640 1.848 N GSPT1 n/a
9 TRCN0000088089 GCAGGTGTCAAACACTTAATT pLKO.1 1364 CDS 100% 15.000 9.000 N Gspt1 n/a
10 TRCN0000309363 GCAGGTGTCAAACACTTAATT pLKO_005 1364 CDS 100% 15.000 9.000 N Gspt1 n/a
11 TRCN0000088088 CCTTTCAAACTTCGCTTCCTT pLKO.1 2444 3UTR 100% 3.000 1.800 N Gspt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130008.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13865 pDONR223 99.5% 90.8% 94.5% None (many diffs) n/a
2 ccsbBroad304_13865 pLX_304 0% 90.8% 94.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_07927 pDONR223 100% 82.6% 85.1% None (many diffs) n/a
4 ccsbBroad304_07927 pLX_304 0% 82.6% 85.1% V5 (many diffs) n/a
5 TRCN0000465826 GCACAAGACTGCGTGCGGCTCAGA pLX_317 18.4% 82.6% 85.1% V5 (many diffs) n/a
Download CSV