Transcript: Mouse NM_001130476.2

Mus musculus protein-tyrosine sulfotransferase 1 (Tpst1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Tpst1 (22021)
Length:
2054
CDS:
394..1506

Additional Resources:

NCBI RefSeq record:
NM_001130476.2
NBCI Gene record:
Tpst1 (22021)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001130476.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103181 CGTCAGTACATTCAATGATTT pLKO.1 956 CDS 100% 13.200 18.480 N Tpst1 n/a
2 TRCN0000103182 CCGGTCCAGTAAAGAGAAGAT pLKO.1 738 CDS 100% 4.950 6.930 N Tpst1 n/a
3 TRCN0000103184 CCTCGACATCAAAGCCAACAA pLKO.1 555 CDS 100% 4.950 3.960 N Tpst1 n/a
4 TRCN0000103183 CTCTTAAAGTTCCTCCATATT pLKO.1 1150 CDS 100% 13.200 9.240 N Tpst1 n/a
5 TRCN0000103180 CCAGTCTTTAATTTCAAGGAA pLKO.1 1777 3UTR 100% 3.000 2.100 N Tpst1 n/a
6 TRCN0000035760 CCTATCACAAAGATATGCCTT pLKO.1 584 CDS 100% 2.640 1.848 N TPST1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130476.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01932 pDONR223 100% 89.3% 96.4% None (many diffs) n/a
2 ccsbBroad304_01932 pLX_304 0% 89.3% 96.4% V5 (many diffs) n/a
3 TRCN0000472880 GCCGCAAAGCACGGCGATCTAAAC pLX_317 49.9% 89.3% 96.4% V5 (many diffs) n/a
Download CSV