Transcript: Human NM_001130527.3

Homo sapiens sperm associated antigen 9 (SPAG9), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SPAG9 (9043)
Length:
8246
CDS:
213..4148

Additional Resources:

NCBI RefSeq record:
NM_001130527.3
NBCI Gene record:
SPAG9 (9043)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130527.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150066 CCACATAATGTGTGAGCATTT pLKO.1 4248 3UTR 100% 10.800 8.640 N SPAG9 n/a
2 TRCN0000281191 CCACATAATGTGTGAGCATTT pLKO_005 4248 3UTR 100% 10.800 8.640 N SPAG9 n/a
3 TRCN0000148625 CGTCTCTTCTGCATGGTTTAT pLKO.1 4180 3UTR 100% 13.200 9.240 N SPAG9 n/a
4 TRCN0000281123 CGTCTCTTCTGCATGGTTTAT pLKO_005 4180 3UTR 100% 13.200 9.240 N SPAG9 n/a
5 TRCN0000148831 CCCGAGTGGAATCTTTAGAAT pLKO.1 568 CDS 100% 5.625 3.938 N SPAG9 n/a
6 TRCN0000281124 CCCGAGTGGAATCTTTAGAAT pLKO_005 568 CDS 100% 5.625 3.938 N SPAG9 n/a
7 TRCN0000147423 GCCTTTGATTTCCTTAGTGAA pLKO.1 1998 CDS 100% 4.950 3.465 N SPAG9 n/a
8 TRCN0000148106 GCGCCAAATAAATCAGAGATA pLKO.1 1089 CDS 100% 4.950 3.465 N SPAG9 n/a
9 TRCN0000281122 GCGCCAAATAAATCAGAGATA pLKO_005 1089 CDS 100% 4.950 3.465 N SPAG9 n/a
10 TRCN0000148340 CCAGGGACATTTATACCCTAT pLKO.1 3789 CDS 100% 4.050 2.835 N SPAG9 n/a
11 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 5379 3UTR 100% 4.950 2.475 Y GJD4 n/a
12 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 5379 3UTR 100% 4.950 2.475 Y C9orf85 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130527.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11327 pDONR223 100% 8% 4.2% None (many diffs) n/a
2 ccsbBroad304_11327 pLX_304 0% 8% 4.2% V5 (many diffs) n/a
3 TRCN0000479460 CGCTGAGTTCATAGCAAGTCTTAT pLX_317 87.6% 8% 4.2% V5 (many diffs) n/a
Download CSV